Informations

C8. Protéines kinases activées par les mitogènes - Biologie

C8. Protéines kinases activées par les mitogènes - Biologie


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

C'est souvent le cas que des récepteurs occupés activent des protéines kinases, qui activent d'autres protéines kinases, qui activent encore d'autres protéines kinases pour produire des phospho-protéines qui peuvent agir comme facteurs de transcription. Un exemple est la protéine kinase activée par un mitogène (système MAPK). Un mitogène est un signal chimique externe qui provoque la mitose ou la division cellulaire. L'activation des facteurs de transcription par leur phosphorylation via une kinase activée par un mitogène est requise. La séquence des événements est :

  • liaison du signal externe au récepteur membranaire et activation du récepteur kinase
  • phosphorylation de la kinase réceptrice et interaction avec une protéine de liaison au GTP activatrice comme ras
  • liaison d'une protéine G activée à et activation d'une protéine kinase kinase kinase activée par un mitogène (MAPKKK)
  • MKKK phosphoryle et active une autre kinase, MAPKK
  • MKK phosphoryle et active la protéine kinase activée par un mitogène, MAPK
  • MAPK phosphoryle les facteurs de transcription inactifs (ou d'autres protéines) et les active. Malheureusement (d'un point de vue nominatif) lorsque les protéines activées sont elles-mêmes des protéines kinases, elles sont appelées protéines kinases activées par les mitogènes (MAPKAPK)

Il existe sept types de MAPK, quatre classiques et trois atypiques. Quatre types sont décrits dans le tableau ci-dessous.

Protéine de liaison activatrice GTPRas : GTP
MAPKKK ou MAPK3Raf-1A/B
c-Mos
MEKK1-4
DLK
MLK2
MEKK1-4
DLK
MLK2
MEKK2/3
Tpl-2
MAPKK ou MAPK2MEK1,2MEK4,7MEK3,6MEK5
MAPK ou MAKERK1,2JNK1-3p38ERK5
MAPKAPKRSK 1-4
MNK2
MSK 1,2
MK2,3MSK1,2
MK2,3
RSK1-4
Un éventuel
Cible protéique
c-juinc-juin

Système MAP Kinase à partir de la signalisation cellulaire

Animation du système MAP Kinase de Promega

Contributeurs

  • Prof. Henry Jakubowski (College of St. Benedict/St. John's University)

Protéine C juin

D Rôle de c-Jun dans les interactions cellulaires Axon-Schwann

Le facteur de transcription c-Jun, qui appartient à la famille des facteurs de transcription bZIP ( 199 ), est exclusivement exprimé par des cellules de Schwann non myélinisantes dans un nerf normal et par des cellules de Schwann préalablement myélinisantes après une lésion ( 200 ). Au cours du développement et de la régénération du SNP, le modèle d'expression de c-Jun est cohérent avec sa régulation par les interactions axone-cellule de Schwann. Ainsi, c-Jun est susceptible d'être impliqué dans la détermination de l'état différencié des cellules de Schwann non myélinisantes et dépourvues d'axones, bien que les gènes cibles de ce facteur de transcription dans ces cellules restent à déterminer.


Introduction

Les protéines kinases activées par les mitogènes (MAPK) sont exprimées de manière ubiquitaire et régulent une grande variété de fonctions dans pratiquement tous les types de cellules. Chez les vertébrés, cinq familles de MAPK codées par 11 gènes différents comprennent la kinase régulée par le signal extracellulaire ERK1/2, la kinase c-Jun N-terminale JNK1/2/3, p38??/??/??/??, ERK5 et ERK7 (Uhlik et al., 2004). Des variantes d'épissage existent pour plusieurs des protéines MAPK. Les MAPK phosphorylent des protéines substrats spécifiques qui régulent la prolifération, la survie, la motilité, le métabolisme, la transcription et la traduction cellulaires. Les MAPK contribuent à la réponse cellulaire à divers stimuli, y compris les facteurs de croissance, les cytokines et les stress tels que les toxines, de nombreux médicaments, les changements dans l'adhérence cellulaire, l'osmolarité, les radicaux oxygène, la lumière ultraviolette et la température (Pearson et al., 2001). Il n'est donc pas surprenant que l'activité MAPK dérégulée soit associée à une variété d'états pathologiques, y compris ceux résultant de l'inflammation, tels que l'arthrite et les maladies inflammatoires de l'intestin (Johnson et Lapadat, 2002 Hollenbach et al., 2004), ainsi que des syndromes qui comprennent la prolifération cellulaire incontrôlée et le remodelage tissulaire caractéristiques du cancer (Gollob et al., 2006).

La compréhension de la façon dont l'un des ensembles de stimuli qui activent les MAPK peut induire un résultat spécifique a été l'objectif d'un effort de recherche intensif. Les MAPK sont la kinase terminale dans un module de phosphorelay à trois kinases, dans lequel les MAPK sont phosphorylées et activées par les MKK de protéine kinase kinase activée par un mitogène, qui elles-mêmes sont phosphorylées et activées par la protéine kinase kinase kinase activée par un mitogène (MKKK). Parmi les composants du module de signalisation MAPK qui ont été identifiés dans les cellules humaines, les MKKK sont les plus nombreux (au moins 20 gènes), par rapport aux MKK (sept gènes) et aux MAPK (11 gènes) (Uhlik et al., 2004) . Les nombres de chaque MKKK, MKK et MAPK sont en fait plus grands lorsque les variantes d'épissure sont comptées. Fait intéressant, certains MKKK peuvent activer différents modules MAPK, ou activer le même module avec une durée ou une localisation modifiée pour rendre des résultats distincts (Johnson et al., 2005). Compte tenu de la variété des stimuli connus pour activer les différentes MAPK, la diversité des MKKK représente un mécanisme prédominant par lequel la spécificité est obtenue dans l'activation des MAPK. Reformulé, les MKKK peuvent acheminer des signaux provenant d'entrées très différentes vers des modules de signalisation MAPK pour fournir des réponses fonctionnelles spécifiques. En ce sens, les MKKK représentent des nœuds organisationnels ou des « hubs » qui intègrent des réponses pour fournir une spécificité dans l'activation de MAPK.

La figure 1 illustre un schéma de câblage pour quatre des 20 MKKK. Les MEKK ont une homologie significative dans leurs domaines de kinase (voir ci-dessous) et régulent de manière différentielle plus d'une MAPK (Fanger et al., 1997 Yujiri et al., 1998 Abell et al., 2005). Les connexions dans le schéma de câblage représentent les interactions protéiques basées sur les données publiées dans PubMed. De plus, des knock-outs de gènes ciblés chez la souris pour MEKK1-4 ont été caractérisés (Yujiri et al., 1998 Garrington et al., 2000 Yang et al., 2000 Abell et al., 2005). Les phénotypes knock-out pour MEKK1, 2, 3 et 4 définissent clairement des modules spécifiques dans la carte des connexions qui ont défini des rôles physiologiques essentiels pour chaque MEKK. Pour une telle carte de connexions, un module peut être défini comme une unité de fonction discrète qui est séparable des autres composants du système. Un exemple est le module MEKK3-OSM-KRIT qui régule l'intégrité vasculaire cérébrale. La mutation de l'OSM ou du KRIT entraîne la maladie des malformations caverneuses cérébrales (CCM) qui touche une personne sur 200 aux États-Unis (Sahoo et al., 1999 Zawistowski et al., 2005). On peut imaginer la complexité d'une telle carte de connexions pour les 20 MKKK. Dans cette revue, nous examinons les mécanismes par lesquels les MKKK intègrent des signaux d'origines diverses pour obtenir des résultats fonctionnels spécifiques de l'activation de MAPK.

Carte des connexions montrant les interactions protéiques pour MEKK1, 2, 3 et 4. La carte des connexions illustre les MEKK en tant que hubs de signalisation fonctionnels pour l'intégration de plusieurs entrées en amont dans le contrôle de MAPK spécifiques. Les cartes ont été créées à partir de recherches dans la base de données PubMed et d'un filtrage des données basé sur les phénotypes de souris ayant une perturbation génique ciblée ou des knockins inactivant la kinase de chaque MEKK. Les codes de couleur représentent différentes classes de protéines ou de voies qui alimentent les quatre MEKK. Le vert représente les protéines d'échafaudage et les récepteurs qui utilisent les échafaudages pour stimuler une réponse. Le rose représente les tyrosine kinases. Le bleu clair représente les sérine-thréonine kinases. Le rouge représente les récepteurs et les régulateurs de la réponse des récepteurs. Le jaune représente les GTPases.


MATÉRIAUX ET MÉTHODES

Matériaux

Les amorces de RT-PCR ont été obtenues auprès de TIB Molbiol (Berlin, Allemagne). Les anticorps secondaires provenaient de Li-Cor Biosciences (Lincoln, NE, USA). Skepinone-L a été synthétisé comme décrit précédemment (14). Matériaux utilisés : CAY10566, Cayman (Ann Arbor, MI, USA) FlexiTube GeneSolution siRNA dirigés contre SCD-1 (Qiagen, Hilden, Allemagne) sérum de chèvre non immun, Invitrogen (Carlsbad, CA, USA) DMEM/hyperglycémie (4,5 g /L) milieu, solution trypsine/EDTA (PAA Laboratories, Coelbe, Allemagne) souris anti-cycline D1 (1:2000), lapin anti-cycline B1 (1:1000), souris anti-cycline E (1:1000), anti-β-actine de lapin ou de souris (1:1000), anti-phospho-ERK1/2 de souris (Thr202/Tyr204 1:2000), anti-phospho-MEK1/2 de lapin (Ser217/221 1:1000) anti- substrats de C-kinase riches en alanine phospho-myristoylée (Ser152/156 1:1000), anti-caspase de lapin 3 (1:1000), anti-phospho-Src de la famille de lapin (Tyr416 1:1000) anti-phospho-JNK de souris ( Thr183/Tyr185 1:2000), lapin anti-phospho-Akt (Ser473 1:1000), lapin anti-phospho-p38 MAPK (Thr180/Tyr182 1:1000), lapin anti-p38 MAPK (1:1000), souris anti -IκBα (1:1000), souris anti-CHOP (1:1000), lapin anti-ATF-4 (1:1000), lapin anti-BiP (1:1000 : Cell Signaling, Danvers, MA, USA) souris anti- -e réticulum ndoplasmique/compartiment intermédiaire de Golgi (ERGIC) 53, Enzo Life Sciences (Lörrach, Allemagne) standards lipidiques (Avanti Polar Lipids, Alabaster, AL, USA) 1, 2- 3 H-2-deoxy-D-glucose (Hartmann Analytics, Braunschweig, Allemagne) les solvants et tous les autres produits chimiques ont été obtenus auprès de Sigma-Aldrich (St. Louis, MO, USA) ou Wako Pure Chemicals (Osaka, Japon) sauf indication contraire.

Cellules, différenciation cellulaire et synchronisation du cycle cellulaire

Des fibroblastes de souris NIH-3T3 et 3T3-L1 ont été cultivés à 37°C et 5% de CO2 dans du DMEM additionné de 10 % (v/v) de FCS inactivé par la chaleur. Pour synchroniser les cellules NIH-3T3 en phase G2/M du cycle cellulaire, les cellules (70-80 % confluentes) ont été traitées avec du nocodazole (0,4 g/ml) dans du DMEM supplémenté avec 10 % de sérum de veau foetal (FCS) pendant 20 heures (37°C, 5% CO2) comme décrit ailleurs (15). Les cellules mitotiques rondes ont été détachées par oscillation et giclement, lavées 3 fois avec du PBS glacé pH 7,4 et réensemencées à 4 × 10 6 cellules/ballon de 75 cm 2 .

Les fibroblastes 3T3-L1 ont été différenciés en adipocytes comme décrit ailleurs (16). Les cellules postconfluentes (plaque à 12 puits) ont été traitées avec du DMEM contenant 10 % de FCS, 1 g/ml d'insuline, 1 M de dexaméthasone et 0,5 mM de 3-isobutyl-1-méthylxanthine pendant 2 jours (37 °C, 5 % de CO2) puis cultivés pendant 2 jours supplémentaires dans du DMEM plus 10 % de FCS et 1 g/ml d'insuline.

Détermination du nombre de cellules et de la viabilité des cellules

Les cellules totales et viables ont été comptées après coloration au bleu trypan en utilisant un compteur de cellules Vi-Cell Series (Beckman Coulter, Krefeld, Allemagne). Alternativement, la viabilité cellulaire a été mesurée en utilisant le dosage colorimétrique de réduction de colorant au bleu de thiazolyle et de tétrazolium (MTT). Des cellules NIH-3T3 (7 × 10 3 /plaque 96 puits) ont été cultivées pendant 16 h (37°C, 5% CO2) puis pré-incubé avec un véhicule (DMSO) ou CAY10566 pendant 48 heures. Du MTT a été ajouté, le produit formazan a été solubilisé avec du SDS (10 %, m/v, dans 20 mM de HCl) après 3 heures, et l'absorbance a été lue à 595 nm comme décrit ailleurs (17).

Inhibition de SCD-1 par ARN interférence

Des cellules NIH-3T3 ont été cultivées à environ 60% de confluence dans des boîtes de 25 cm 2 et transfectées avec des oligonucléotides duplex siRNA (15 nM) en utilisant le réactif de transfection Lipofectamine RNAiMax (10 l, Invitrogen) selon le protocole du fabricant. Les 3 siRNA SCD-1 ciblaient les séquences 1) 5'-CACAACAGCTTTAAATAATAA-3', 2) 5'-TAGTGAGATTTGAATAATTAA-3' et 3) 5'-CCGGTACAGTATTCTTATAAA-3', respectivement. On-TargetPlus non ciblant l'ARNsi #1 (Thermo Scientific, Waltham, MA, USA) a été utilisé comme ARNsi de contrôle brouillé.

Extraction des lipides

Les lipides ont été extraits des cellules NIH-3T3 (5 × 10 5 dans du PBS pH 7,4) par addition successive de méthanol, de chloroforme et de solution saline (rapport final : 14 : 34 : 35 : 17) comme décrit précédemment (18). La couche organique a été évaporée et les lipides extraits ont été dissous dans 100 pi de méthanol et dilués, et du 1,2-dimyristoyl-sn-glycéro-3-phosphatidylcholine et 1, 2-dimyristoyl-sn-glycéro-3-phosphatidyléthanolamine ont été utilisés comme étalons internes.

Chromatographie liquide en phase inversée

Les lipides ont été séparés sur une colonne Acquity UPLC BEH C8 (1,7 m, 1 × 100 mm, Waters, Milford, MA, USA) en utilisant un système Acquity Ultraperformance LC (Waters) comme décrit précédemment (15). Pour l'analyse des phospholipides, la chromatographie a été réalisée à un débit de 0,75 ml/min à 45°C en utilisant un gradient de 30 % de phase mobile A (acétonitrile/eau, 10/90, 10 mM d'acétate d'ammonium)/70 % de phase mobile B ( acétonitrile/eau, 95/5, 10 mM d'acétate d'ammonium) à 20 % de phase mobile A/80 % de phase mobile B en 5 minutes et à 100 % de phase mobile B en 2 minutes suivi d'une élution isocratique pendant 2 minutes supplémentaires. Les triacylglycérols et l'ester de cholestérol ont été séparés à un débit de 0,75 ml/min à 45°C en utilisant un gradient de 100 % de phase mobile A (acétonitrile/eau, 95:5, 10 mM d'acétate d'ammonium) à 70 % de phase mobile A/20 % de phase mobile B (isopropanol) dans les 6 minutes et élution isocratique subséquente pendant 3 minutes.

Spectrométrie de masse

Le système de chromatographie a été couplé à un spectromètre de masse QTRAP 5500 (AB Sciex, Darmstadt, Allemagne) ou à un spectromètre de masse quadripolaire à trois étages Vantage (Thermo Scientific pour l'analyse du cycle cellulaire). Tous deux étaient équipés de sources d'ionisation électrospray. La quantification des glycérophospholipides à l'aide du spectromètre de masse QTRAP 5500 était basée sur la détection des deux fragments d'anions d'acides gras grâce à la surveillance de réactions multiples selon (15). La transition la plus intensive a été sélectionnée pour la quantification. La tension de pulvérisation ionique a été réglée à 4500 V en mode ion négatif la température du capillaire chauffé à 350-700°C la pression du gaz gaine à 45-55 psi la pression du gaz auxiliaire à 75-80 psi le potentiel de désagrégation à 40-50 V et l'énergie de collision à 46, 38, 20, 62 et 52 V pour les phosphatidylcholines, les éthanolamines, les sérines, le PI et les phosphatidylglycérols, respectivement. Les sphingomyélines ont été quantifiées en [M + H + ] par m/z =184 balayages d'ions précurseurs (énergie de collision : 33 V).

À l'aide du spectromètre de masse quadripolaire à trois étages Vantage, les changements dépendants du cycle cellulaire dans la composition lipidique ont été surveillés par m/z = 184 balayages d'ions précurseurs en mode ion positif (énergie de collision: phosphatidylcholines et sphingomyélines 35 V) ou balayages complets en mode ion négatif (tous les autres phospholipides) comme décrit ailleurs (19). Les groupes de tête phosphatidyléthanolamine et -sérine ont été confirmés par m = 141,0 ou m = 87,0 balayages à perte neutre (énergie de collision : 25 V, mode ionique positif et négatif, respectivement) et les groupes de tête phosphatidylcholine et PI par m/z = 184 ou m/z = 241,0 balayages d'ions précurseurs (énergie de collision : 35 V, mode ionique positif et négatif, respectivement) . La composition en acides gras a été déterminée à une énergie de collision de 40 V par des balayages d'ions produits. L'intensité plus élevée du signal de sn-1 que sn-2 anions d'acide gras a été utilisé pour estimer la position isomérique des acides gras (20).

Les triacylglycérols et l'ester de cholestérol ont été analysés en tant que produits d'addition [M + NH4] + par surveillance de réactions multiples à l'aide d'un spectromètre de masse QTRAP 5500. Les transitions vers [M-anion d'acide gras] + fragments ont été mesurées pour l'identification des lipides. La transition la plus intensive (et spécifique à l'espèce) a été sélectionnée pour la quantification. Les positions isomères des acides gras dans les triacylglycérols n'ont pas été déterminées. En variante des réglages décrits et référencés ci-dessus, la tension de pulvérisation ionique a été réglée à 5500 V en mode ion positif, la température capillaire chauffée à 350-400°C, la pression du gaz gaine à 55-60 psi, la pression du gaz auxiliaire à 70 psi, le potentiel de désagrégation à 55-120 V et l'énergie de collision à 35 V (triacylglycérols) ou 22 V (ester de cholestérol).

Les spectres de masse ont été traités à l'aide du logiciel Analyst 1.6 (AB Sciex) ou Xcalibur 2.0 (Thermo Scientific) comme décrit ailleurs (15, 20). La proportion d'espèces lipidiques (=intensité relative) est donnée en pourcentage de la somme de toutes les espèces de la sous-classe respective (=100%). Les intensités totales de la sous-classe de phospholipides combinent les intensités de toutes les espèces de la sous-classe respective et ont été normalisées par rapport au nombre de cellules et à l'étalon interne 1, 2-dimyristoyl-sn-glycéro-3-phosphatidylcholine.

Préparation des échantillons, SDS-PAGE et Western blot

Les cellules ont été sonifiées (2 × 5 s, sur glace) dans 20 mM Tris-HCl pH 7,4, 150 mM NaCl, 2 mM EDTA, 1% (v/v) Triton X-100, 1 mM fluorure de phénylméthanesulfonyle, 60 g/ml inhibiteur de trypsine de soja, 10 g/ml de leupeptine, 5 mM de fluorure de sodium, 1 mM de vanadate de sodium et 2,5 mM de pyrophosphate de sodium. Après centrifugation (12 000 g, 5 min, 4°C), le surnageant a été repris dans 1 x tampon de chargement d'échantillon SDS/PAGE [125 mM Tris-HCl pH 6,5, 25 % (m/v) saccharose, 5 % SDS (m/v), 0,25 % (m/v) de bleu de bromophénol et 5 % (v/v) de β-mercaptoéthanol] et bouillir pendant 5 minutes à 95°C. Des aliquotes (10 ug de protéine) ont été résolues par SDS-PAGE à 10 ou 12 % (m/v) et transférées sur une membrane de nitrocellulose Hybond ECL (GE Healthcare, Munich, Allemagne). Les membranes ont été bloquées avec 5% (m/v) de BSA ou de lait écrémé pendant 1 heure à température ambiante et incubées avec des anticorps primaires pendant une nuit à 4°C. Les bandes immunoréactives ont été colorées avec des IgG anti-lapin ou anti-souris marquées à l'IRDye 800CW (1:10 000, chacune) et/ou à l'IRDye 680LT (1:80 000, chacune) et visualisées par un imageur infrarouge Odyssey (Li-Cor Biosciences ). Les données de l'analyse densitométrique ont été corrigées en fonction du bruit de fond.

Supplémentation en acides gras

Le milieu de culture des cellules NIH-3T3 a été remplacé par du DMEM contenant 10 % (v/v) de FCS inactivé par la chaleur plus du palmitate, du palmitoléate ou de l'oléate aux concentrations indiquées. Le milieu de culture additionné de 400 M de palmitate a été soniqué à 40°C pendant 20 minutes avant utilisation. Les cellules ont été incubées à 37°C et 5% CO2 pour les heures indiquées.

Absorption cellulaire du 2-désoxy-D-glucose

L'absorption cellulaire du 2-désoxy-D-glucose a été déterminée selon Yand et Yao (16). Des adipocytes 3T3-L1 différenciés (flacon de 25 cm2) ont été traités avec CAY10566 (3 M), Skepinone-L (1 M) ou véhicule (DMSO) pendant 48 heures (37°C, 5% CO2). Les cellules ont été lavées, additionnées de véhicule (DMSO), de Skepinone-L (1 M) ou de l'inhibiteur de contrôle cytochalasine B, et stimulées avec de l'insuline (100 nM) dans du tampon phosphate de sodium 10 mM HEPES/10 mM (pH 7,4) contenant 128 chlorure de sodium mM, chlorure de potassium 4,7 mM, chlorure de calcium 1,25 mM et sulfate de magnésium 1,25 mM pendant 15 minutes. Ensuite, du 2-désoxy-D-glucose marqué au 3H (0,5 uCi/ml à 0,5 mM) a été ajouté.Après 10 minutes, les cellules ont été lavées 3 fois avec du PBS glacé pH 7,4 plus 10 mM de glucose, immédiatement lysées dans 0,1 N de NaOH et mélangées avec du Rotiszint eco plus (3 ml, Carl Roth GmbH, Karlsruhe, Allemagne) pour un comptage par scintillation liquide en utilisant un analyseur à scintillation liquide Packard TRI-CARB 2100TR.

Coloration par immunofluorescence et microscopie

Des cellules NIH-3T3 (2 × 10 4 /cm 2 ) ont été ensemencées sur des lamelles et cultivées en présence de CAY10566 (3 M), Skepinone-L (1 M) ou véhicule (DMSO 37°C, 5% CO2). Le milieu de culture a été remplacé après 42 heures contre du milieu de culture contenant du palmitate (400 µM) plus CAY10566 (3 µM), Skepinone-L (1 µM), ou véhicule (DMSO). Cette étape a été omise pour les expériences utilisant des cellules non stressées. Après 6 heures, les échantillons ont été fixés avec du paraformaldéhyde à 4 %, perméabilisés avec du Triton X-100 à 0,3 % et bloqués avec du sérum de chèvre normal à 5 ​​% (10 minutes, température ambiante). Les échantillons ont été incubés avec un anticorps anti-ERGIC53 de souris (1:100 Enzo Life Sciences) pendant 1 heure à température ambiante suivi d'IgG anti-souris de chèvre Alexa Fluor 555 (1:1000 1 heure, Invitrogen à température ambiante). L'ADN a été coloré avec 0,1 ug/ml de DAPI pendant 3 minutes à température ambiante. Les lamelles ont été montées sur des lames de verre avec du Mowiol contenant 2,5 % de gallate de n-propyle (Sigma-Aldrich). La fluorescence a été visualisée avec un microscope Axio Observer.Z1 et un objectif Plan-Apochromat 40X/1.3 Oil DIC M27 (tous deux de Carl Zeiss GmbH, Jena Allemagne). Les images ont été prises à température ambiante avec une caméra AxioCam MR3 et ont été acquises, coupées, ajustées linéairement dans la luminosité et le contraste globaux, et exportées au format TIF par le logiciel AxioVision 4.8 (Carl Zeiss GmbH).

Gène Amorce sens (5′ → 3′) Primer anti-sens (5′ → 3′)
mSCD-1 CATCATTCTCATGGTCCTGCTG AGCCGTGCCTTGTAAGTTCTGT
mSCD-2 GGAGGAACATCATTCTCATGGC AGCCGTGCCTTGTATGTTCTGT
mβ-actine GCTGTGCTATGTTGCTCTAGACTT AATTGAATGTAGTTTCATGGATGC
mGAPDH TGACAATGAATACGGCTACAGCA CTCCTGTTATTATGGGGGTCTGG

RT-PCR quantitative

L'ARN total a été préparé en utilisant E.Z.N.A. Kit ARN total I (Omega Bio-tek, Norcross, GA, USA). Les ADNc de premier brin ont été synthétisés à partir de 1 ug d'ARN en utilisant Superscript III (Invitrogen). La PCR a été réalisée dans des plaques 96 puits Mx3000P (25 l) en utilisant un système qPCR Mx3005P (Agilent Technologies, Santa Clara, CA, USA). Le mélange PCR contenait de l'ADNc (2,5 l), le Maxima SYBR Green/Rox qPCR Master Mix (1x, Thermo Scientific) et des amorces directes et inverses (0,5 M, chacune). Les informations sur l'amorce sont fournies dans Table 1. Le programme de cycle a commencé avec 10 minutes à 95°C et comprenait 40 cycles de 15 secondes à 95°C, 30 secondes à 63°C et 30 secondes à 72°C. Les niveaux d'ADNc ont été quantifiés à l'aide du logiciel MxPro QPCR. L'expression de l'ARNm a été normalisée à la glycéraldéhyde-3-phosphate déshydrogénase pour les expériences de précipitation ou à la quantité d'ARN pour les études du cycle cellulaire. Les résultats sont donnés en unités arbitraires.

Statistiques

Les données sont présentées sous forme de moyenne ± ET de m constats. L'évaluation statistique des données a été réalisée par des ANOVA à un facteur pour des échantillons indépendants ou corrélés, suivies de la différence significative honnête (HSD) de Tukey. post-hoc tests ou par l'étudiant t tester les échantillons appariés et corrélés. Les valeurs de P <0,05 ont été considérées comme statistiquement significatives. Tous les calculs statistiques ont été effectués en utilisant GraphPad InStat 3.10 (GraphPad Software Inc., La Jolla, CA, USA).


Résultats

Phosphopeptides identifiés

(a) Le but de cette étude était d'établir, en tant que voie de routine, une méthode d'identification et de caractérisation des kinases phosphorylées individuelles p38 et HuR in vitro en utilisant : TiO2, IMAC, SIMAC couplés à MSA et MS3NL sur le spectromètre de masse LTQ ion Trap (Thermo). Les protéines de purification et de fusion ont été exprimées dans Escherichia coli. Le dosage de la kinase a été réalisé en incubation avec différents types d'inhibiteurs de la protéine phosphatase afin d'augmenter les niveaux de phosphorylation des protéines-kinases avant l'analyse. En effet, le pervanadate de sodium, un inhibiteur de tyrosine phosphatase, couplé à une combinaison de deux cocktails inhibiteurs de phosphatase de Sigma (un cocktail contenant des inhibiteurs de sérine/thréonine phosphatase et un contenant des inhibiteurs de tyrosine phosphatase) a également été utilisé. Les protéines kinases ont été digérées avec de la lysyl endopeptidase et de la trypsine, puis enrichies en peptides phosphorylés à l'aide de TiO.2, les phosphoenrichissements IMAC et SIMAC. Les phosphopeptides isolés ont été dessalés, nettoyés et analysés par nano-LC ESI-MS/MS à l'aide d'un instrument Thermo LTQ ion Trap MSMS. Toutes les expériences ont été réalisées en triple. Les expériences LC-MS/MS et la recherche dans la base de données Mascot ont abouti à des résultats significatifs globaux pour les peptides. Tous les peptides ont été déterminés avec une erreur de masse inférieure à 5,5 ppm. Un total de 6 phosphopeptides ont été validés par évaluation manuelle des ensembles de données LC-MS/MS obtenus à partir des quatre expériences en triple. Parmi celles-ci, 6 ont été attribuées à des séquences phosphorylées d'acides aminés uniques, ce qui a permis d'identifier 3 protéines uniques dans toutes les expériences.

(b) L'analyse des 5 l (

3 g) de l'échantillon purifié par IMAC et dessalé et nettoyé par R3/C18 nous a permis d'obtenir 2 peptides phosphorylés inconnus lors de l'utilisation de MSA sur l'instrument nano-LC-LTQ ion Trap. Les deux peptides phosphorylés ont été validés manuellement et correspondent à : R.VLVDQTTGLSR.G et R.SLFSSIGÈVESAK.L. Ces deux phosphopeptides appartiennent à la protéine de liaison à l'ARN HuR gi/1022961. L'analyse de 5 l (

3 µg) de l'échantillon purifié par TiO2 et dessalés et nettoyés par R3/C18 nous ont permis d'obtenir 4 peptides phosphorylés inconnus lors de l'utilisation de MSA sur l'instrument nano-LC-LTQ.

Les quatre peptides phosphorylés ont été validés manuellement et correspondent à : R.VLVDQTTGLSR.G, R.SLFSSIGÈVESAK.L, K.DVEDMFSR.F qui appartiennent à la protéine de liaison à l'ARN HuR gi/1022961 et à un autre phosphopeptide : K.DLSSIFR.G qui appartient à la p38 MAP Kinase gi/1469306 (Tableau 1).

3 g) de l'échantillon purifié par SIMAC et dessalé et nettoyé par R3/C18 nous a permis d'obtenir 6 peptides phosphorylés inconnus lors de l'utilisation de MSA sur l'instrument nano-LC-LTQ ion Trap. Les six peptides phosphorylés ont été validés manuellement et correspondent à : K.DVEDMFSR.F, R.VLVDQTTGLSR.G, K.DANLYISGLPR.T, R.SLFSSIGÈVESAK.L qui appartiennent à la protéine de liaison à l'ARN HuR gi/1022961 et R.TAVINAASGR.Q qui appartient à la chaîne B, Structure Of Appbp1-Uba3-nedd8-Mgatp-Ubc12 (c111a), A Trapped Ubiquitin-Like Protein Activation Complex gi/126031226, et K.DLSSIFR.G qui appartient à la p38 MAP Kinase gi/1469306 (Tableau 1).

Par conséquent, lors de l'utilisation du MSA par l'instrument LTQ Ion Trap, l'efficacité du SIMAC (6 phosphopeptides purifiés, identifiés et validés) est supérieure à celle du TiO2 (4 phosphopeptides purifiés et identifiés) et IMAC (2 phosphopeptides purifiés, identifiés et validés) pour ces protéines-kinases étudiées. Il a été décrit qu'IMAC enrichit facilement plusieurs peptides phosphorylés tandis que TiO2 les monophosphorylés. En fait, SIMAC a été optimisé pour obtenir la meilleure efficacité d'IMAC et TiO2 et compléter les deux en une seule méthode (voir la référence précédemment mentionnée [34]). Cela prend en charge nos données.

Dans tous les cas, nous recommandons que pour étudier les protéines kinases phosphorylées kinase, combiner les trois résines (ou toujours plus de méthodes d'enrichissements phosphoniques) afin de purifier le plus de phosphopeptides possible [46]. La raison en est que chaque échantillon doit être optimisé et testé avec différentes stratégies complémentaires. L'analyse des 5 l (

3 g) de l'échantillon purifié par SIMAC et dessalé et nettoyé par R3/C18 nous a permis d'obtenir 5 peptides phosphorylés inconnus lors de l'utilisation de la perte neutre dépendante des données MS3 (DDNLMS3) sur l'instrument nano-LC-LTQ ion Trap. Les cinq peptides phosphorylés ont été validés manuellement et correspondent à : K.DVEDMFSR.F, K.DANLYISGLPR.T, R.SLFSSIGÈVESAK.L qui appartiennent à la protéine de liaison à l'ARN HuR gi/1022961 K.DLSSIFR.G qui appartient à p38 MAP Kinase gi/1469306 et R.TAVINAASGR.Q qui appartient à la chaîne B, Structure Of Appbp1-Uba3-nedd8-Mgatp-Ubc12 (c111a), A Trapped Ubiquitin-Like Protein Activation Complex gi/126031226 (tableau 1).

(c) SIMAC couplé à l'analyse par spectrométrie de masse MAS et MS3-NL. L'approche préférée pour analyser des échantillons en utilisant la spectrométrie de masse est de produire des ions produits structurellement significatifs en utilisant le processus de dissociation ionique. Une méthode communément appelée analyse Data Dependent Neutral Loss MS3 (DDNLMS3) (développée par Coon et ses collaborateurs [47]) permet une fragmentation sélective en isolant un fragment d'ions à perte neutre d'une expérience MS/MS, puis en le soumettant à une dissociation supplémentaire [ 48]. Malgré cela, DDNLMS3 ne nous a pas permis d'obtenir des résultats aussi efficaces que lors de l'utilisation de MSA pour nos analyses de protéines-kinases. Il est bien connu que la production d'ions neutres à perte en MS/MS s'accompagne presque toujours d'une fragmentation partielle de l'ion précurseur et que ces ions fragments diagnostiques sont ensuite perdus lorsque les ions neutres à perte sont isolés pour MS3. L'activation en plusieurs étapes (ou pseudo MS3) nous a permis d'obtenir des spectres qui étaient la combinaison de la fragmentation MS/MS et MS3 et ainsi de retenir plus efficacement les fragments informatifs de l'ion précurseur. Cela est dû au fait que le MSA a produit des ions plus informatifs sur le plan structurel en éliminant l'étape d'isolement des ions entre MS/MS et MS3 pour l'étude des protéines kinases phosphorylées p38 et HuR in vitro. Nous avons observé que - dans cette étude de recherche liée aux protéines précédemment phosphorylées après in vitro L'activation en plusieurs étapes de la réaction kinase était une voie plus rapide vers un spectre plus riche en informations puisque le piège à ions ne nécessite pas de remplissage pour le balayage MS3, comme avec l'expérience de perte neutre traditionnelle (DDNLMS3). Nous avons conclu lors des premiers tests-analyses des protéines kinases in vitro, que par rapport à DDNLMS3, l'activation à plusieurs étages a généré des spectres avec une intensité de signal accrue et un plus grand nombre d'ions structurellement diagnostiques pour les peptides phosphorylés. Nous avons donc choisi le MSA comme voie de routine pour ce type d'analyse (kinases p38 et HuR phosphorylées in vitro). D'autres avantages de l'utilisation de l'activation en plusieurs étapes sont démontrés dans d'autres études sur les phosphopeptides, y compris une analyse à grande échelle [49]. Les spectres riches en informations générés à l'aide de l'activation à plusieurs étages étaient particulièrement importants pour ces composés car il y a souvent une perte significative d'ions de fragments informatifs de séquence générés en MS/MS. Pour cette étude, plus d'ions ont été identifiés avec l'activation en plusieurs étapes qu'avec MS/MS ou MS3 dans la méthode DDNLMS3. De plus, les intensités de signal étaient généralement plus élevées avec l'activation en plusieurs étapes par rapport à la méthode MS/MS ou MS3 de la méthode DDNLMS3. En fait, l'activation en plusieurs étapes a donné plus d'informations pour la suite de phosphopeptides étudiés (tableau 1) (voir un exemple du spectre d'un peptide phosphorylé identifié lors de l'utilisation de SIMAC couplé à MSA dans le spectromètre de masse LTQ ion Trap et Mascot, figure 2) .

Attribution des phospho-sites et validation manuelle du peptide phosphorylé VLVDQ TTph GLSR obtenu par analyse Mascot. La masse monoisotopique du peptide neutre Mr (calc) résultante était de 1267.6173. Les modifications fixes choisies étaient : Carbamidométhyl (C), tandis que pour les modifications variables T7 : Phospho (ST), avec des pertes neutres 97,9769 (indiquées dans le tableau) a été sélectionné. L'ion y5 et b7 sont ceux qui ont permis l'identification de la tréonine (5) comme acide aminé phosphorylé (ph) (T en rouge). De plus, l'empreinte phosphate de la perte neutre (NL) de l'ion parent est également un signal positif de phosphorylation. Six ions b et 8 ions y ont été continuellement appariés respectivement.

Néanmoins, il faut souligner que Jiang et ses collègues ont développé une stratégie de filtrage de classification spécifique pour leurs études (en utilisant différents échantillons) qui a considérablement amélioré la couverture de l'analyse du phosphoprotéome lors de l'utilisation du NLMS3 (voir la référence mentionnée précédemment [48]). En fait, Jiang et ses collaborateurs ont obtenu une couverture plus élevée des identifications de phosphopeptides lors du traitement et du filtrage des méthodes spécifiques qu'ils ont développées pour les spectres de NLMS3, par rapport aux stratégies MS2 et MSA. A ce propos, il faut dire qu'un seul phosphopeptide de plus a été identifié et validé lorsque nous avons utilisé SIMAC couplé à MSA (6 nouveaux phoshopeptides identifiés) par rapport à lorsque nous avons couplé SIMAC à DDNLMS3 (5 nouveaux phosphopeptides identifiés). De plus, ces 5 nouveaux peptides phosphorylés identifiés et leurs affectations de sites phospho dans chaque acide aminé spécifique sont les mêmes suivant les deux stratégies (voir Figure 3 et Tableau 1). De plus, les 6 nouveaux phosphopeptides et affectations de sites phospho ont montré une reproductibilité élevée dans tous les cas au cours des quatre expériences en triple que nous avons réalisées.

L'efficacité et la reproductibilité de la purification et de l'identification des phosphopeptides lors de l'utilisation

3 g de protéines kinases par chaque méthode de résine et/ou de phosphoenrichissement (SIMAC, TiO 2et IMAC) couplé au spectromètre de masse à piège à ions R3/C18 et MSA-LTQ est illustré. [UNE] Quatre expériences en triple ont été réalisées afin d'identifier les phosphopeptides. Les identifications de phospho-sites ont été réalisées à partir d'essais groupés et non groupés (inter- et intra-essais) confirmant une reproductibilité élevée. Les 6 peptides phosphorylés identifiés ont été isolés et validés dans les quatre analyses en triple, non seulement par Mascot (au moins 4 ions -y et -b en continu appariés) mais aussi par inspection manuelle de tous les spectres. SIMAC a permis la purification de 3 protéines phosphorylées : HuR RNA binding, p38 MAP Kinase and Trapped Ubiquitin-Like Protein Activation Complex, et 6 peptides phosphorylés liés aux protéines mentionnées précédemment. TiO2 et IMAC a permis l'isolement de 2 protéines phosphorylées : la liaison à l'ARN HuR et la MAP Kinase p38, et 1 phosphopeptide lié à la liaison à l'ARN HuR de la protéine kinase. [B] SIMAC couplé au MSA a permis l'identification d'un phosphopeptide de plus par rapport au SIMAC couplé au DDNLMS3. Néanmoins, les deux stratégies (SIMAC couplé au MSA et SIMAC couplé au DDNLMS3) ont permis l'identification du même nombre de protéines phosphorylées (3). [C] et [RÉ] Trois protéines phosphorylées et six phosphopeptides ont été identifiés lors de l'utilisation de SIMAC couplé à MSA. De ces trois phosphoprotéines identifiées, six phosphopeptides ont été identifiés : (a) TiO2 couplé à MSA a permis l'identification de deux protéines phosphorylées égales/mêmes et quatre phosphopeptides égaux/mêmes que SIMAC et (b) IMAC a permis l'identification d'une protéine égale/même et de deux phosphopeptides égaux/mêmes. Ainsi, SIMAC est plus efficace que les autres résines testées pour cette étude, tandis que TiO2 et IMAC corroborent la reproductibilité des protéines phosphorylées et des phosphopeptides identifiés.

Toutes nos analyses MS ont été réalisées par le CID. Nous émettons l'hypothèse qu'en combinant le CID avec la fragmentation ETD ou ECD, il est probable que des données plus nombreuses et/ou complémentaires seraient obtenues selon l'étude méthodologique de Navajas et de ses collaborateurs [50]. L'ECD ne se produit que sur le squelette peptidique - ce qui est un avantage - et les groupes phosphate labiles sont laissés intacts sur les ions des fragments c et z résultants, ainsi, l'identification complémentaire d'autres sites de phosphorylation spécifiques serait activée [51, 52]. En conséquence, nous recommandons d'utiliser CID pour commencer et recommanderions de passer à ETD, au cas où vous n'auriez pas pu déterminer le site de phosphorylation, si vous avez la possibilité de l'instrument requis [53-57]. Les phosphopeptides purifiés, identifiés et validés, y compris également les affectations de sites du groupe phosphate sont illustrés dans le tableau 1.

L'efficacité et la reproductibilité de la purification et de l'identification des phosphopeptides lors de l'utilisation

3 g de protéines kinases par résine et/ou méthode de phosphoenrichissement (SIMAC, TiO2 et IMAC) couplé au spectromètre de masse à piège à ions R3/C18 et MSA-LTQ est illustré à la figure 3.

Un exemple d'attribution de phospho-site et de validation manuelle du peptide phosphorylé (VLVDQTTphGLSR) obtenu par l'analyse de Mascot est illustré à la figure 2.

Modélisation bioinformatique et simulations de dynamique moléculaire

Pour étudier l'effet fonctionnel potentiel de la phosphorylation de la sérine dans les emplacements de séquence indiqués ci-dessus, des modèles structurels 3D pour l'état phosphorylé de la MAP kinase p38beta (p38B) et de HuR ont été générés à l'aide de procédures bioinformatiques. Comme le montre la figure 4, le Ser-279 phosphorylé de p38B est situé dans une boucle placée sur la surface externe de la structure protéique, loin du site actif de la kinase. Il est concevable que la phosphorylation de ce résidu n'affecte pas la stabilité de la structure ou le repliement de p38B, mais que les contacts externes avec les protéines d'accompagnement modulent la nature de l'interaction putative (voir référence précédemment mentionnée [39]).

Emplacement du Ser-279 phosphorylé dans la structure protéique de la MAP kinase p38beta humaine (p38B). Un modèle pour la sérine phosphorylée a été localisé dans la position structurelle du résidu Ser-279 dans les coordonnées cristallographiques 3D de p38B (code de la banque de données de protéines : 3GC8). La position du site de liaison à l'ATP est indiquée. Le tracé a été généré à l'aide de PyMOL (DeLano Scientific, San Carlos, CA).

Dans le cas de HuR, un seul des quatre résidus phosphorylés trouvés (Ser-48) tombe dans un domaine de structure de la protéine préalablement cristallisée : le premier motif de reconnaissance d'ARN dimmerisé (voir référence précédemment citée [40]). Ainsi, seul l'effet structurel putatif de l'état phosphorylé et non phosphorylé de Ser-48 a pu être analysé à l'aide d'outils bioinformatiques structurels, notamment la simulation de la dynamique moléculaire (MD).

Comme le montre la figure 5A, Ser-48 est situé dans la surface de gradation, entouré de résidus Glu-47 et Lys-50 qui forment une paire de liaisons salines potentiellement impliquées dans la stabilisation du gradateur.Pour tester l'effet de la présence d'un Ser phosphorylé dans le maintien de la structure quaternaire, deux simulations informatiques MD sans restriction ont été réalisées en présence ou en l'absence d'un Ser phosphorylé en position 48, comme indiqué sous "Matériaux et méthodes". Les résultats obtenus après 10 ns de MD ont montré que, dans le cas de la structure de gradateur non phosphorylée (Ser-48 non phosphorylée), les deux monomères ont expérimenté un déplacement significatif de leurs positions relatives initiales, entraînant une désorganisation complète de la structure quaternaire (Figure 5B -la gauche-). La mesure des valeurs de l'écart quadratique moyen (RMSD) des monomères et du gradateur, ainsi que les distances entre les atomes C des résidus de contact (Glu47A-Lys50B, Ser48A-Ser48B et Lys50A-Glu48B) ont indiqué un déplacement clair et irréversible de les valeurs initiales au cours des premières étapes de la simulation MD (figure 5C, tracés supérieurs). En revanche, lorsque la même simulation MD a été réalisée en présence d'un Ser phosphorylé en position 48 des deux monomères, une stabilisation claire de la structure dimmerisée a été obtenue, ne montrant aucun déplacement par rapport à leur position initiale (figure 5B -droite-) et présentant une constante valeurs des valeurs RMSD et valeurs RMSD invariables et distances entre les résidus de contact (figure 5C, tracés inférieurs).

Effet de la phosphorylation de Ser-48 sur la stabilité de la structure de gradation du premier motif de reconnaissance d'ARN de HuR. [UNE] Structure cristalline du gradateur HuR (code de la banque de données de protéines : 3HI9, chaînes B et D) indiquant la position de Ser-48, Glu-47 et Lys-50 dans la surface de gradation. [B] Position spatiale relative des deux monomères HuR après 10 ns de simulation de dynamique moléculaire (MD) sans restriction des états non phosphorylés (structure rouge, à gauche) et phosphorylés (structure verte, à droite) de Ser-48. La position de la structure initiale du gradateur, avant la simulation MD, est incluse à des fins de comparaison (en gris). Notez le grand déplacement de l'état non phosphorylé contrairement à la stabilité présentée par le gradateur en présence de phosphoSer48. Les positions respectives de Ser-48 et phosphoSer-48 sont indiquées. [C] À gauche : valeurs RMSD mesurées pour le gradateur HuR (rouge) du monomère A (bleu) et du monomère B (vert) pendant la trajectoire de 10 ns de la simulation MD sans restriction du gradateur en présence de Ser-48 non phosphorylé (tracé HUR, panneau supérieur ) ou pSer-48 phosphorylé (graphe HURP, panneau inférieur). A droite : mesure en continu des distances Cα Cα entre les résidus E47(A)-K50(B) (rouge), S48(A)-S48(B) (bleu) et E47(A)-K50(B) (vert), pendant la trajectoire MD. La distorsion du gradateur HuR en présence de Ser-48 (graphique HUR, panneau supérieur) par rapport à l'état phosphorylé de la protéine (graphique HURP, panneau inférieur) est patente dans les mesures RMSD et Cα-Cα. Les graphiques de structure ont été générés comme dans la figure 4.

Ces résultats suggèrent que la phosphorylation de Ser48 dans le premier motif de reconnaissance d'ARN protéique de HuR a potentiellement un effet stabilisant, exerçant un rôle régulateur sur la fonction biologique de la protéine en régulant le maintien de l'état quaternaire dimmerisé, une exigence du complexe avant Activité de liaison à l'ARN [58].


Résumé

La protéine basique de la myéline (MBP) se lie aux lipides chargés négativement sur la surface cytosolique des membranes des oligodendrocytes et est très probablement responsable de l'adhésion de ces surfaces dans la gaine de myéline multicouche. Il peut également polymériser l'actine, regrouper les filaments d'actine F et lier les filaments d'actine aux bicouches lipidiques par le biais d'interactions électrostatiques. La MBP se compose d'un certain nombre d'isomères modifiés de manière post-traductionnelle de charge variable, certains résultant de la phosphorylation sur plusieurs sites par différentes kinases, y compris la protéine kinase activée par les mitogènes (MAPK). La phosphorylation de la MBP dans les oligodendrocytes se produit en réponse à divers stimuli extracellulaires. La phosphorylation/déphosphorylation de la MBP se produit également dans la gaine de myéline en réponse à l'activité électrique dans le cerveau. Ici, nous étudions l'effet de la phosphorylation de la MBP sur son interaction avec l'actine in vitro en phosphorylant l'isomère non modifié le plus fortement chargé, C1, sur deux sites avec MAPK. La phosphorylation a diminué la capacité de la MBP à polymériser l'actine et à regrouper les filaments d'actine, mais n'a eu aucun effet sur la constante de dissociation du complexe MBP-actine ou sur la capacité de Ca 2+ -calmoduline à dissocier le complexe. L'effet le plus significatif de la phosphorylation sur le complexe MBP-actine était une réduction spectaculaire de sa capacité à se lier aux bicouches lipidiques chargées négativement. L'effet était beaucoup plus important que celui rapporté précédemment pour un autre isomère de charge de MBP, C8, dans lequel six arginines ont été désimifiées en citrulline, entraînant une réduction de la charge positive nette de 6. Ces résultats indiquent que bien que les forces électrostatiques moyennes soient le principal déterminant de l'interaction de la MBP avec l'actine, la phosphorylation peut avoir un effet supplémentaire dû à un effet électrostatique spécifique au site ou à un changement de conformation. Ainsi, la phosphorylation de la MBP, qui se produit en réponse à divers signaux extracellulaires à la fois dans la myéline et les oligodendrocytes, atténue la capacité de la MBP à polymériser et à regrouper l'actine et à la lier à une membrane chargée négativement.

Ce travail a été soutenu par une subvention à JMB des Instituts de recherche en santé du Canada.

À qui la correspondance doit être adressée : Division de biologie structurale et de biochimie, Hospital for Sick Children, 555 University Ave., Toronto, ON, Canada M5G 1X8. Tél. : (416) 813-5919. Télécopieur : (416) 813-5022. Courriel : [e-mail protected]

Division de biologie structurale et de biochimie, Institut de recherche, Hospital for Sick Children.

Département de médecine de laboratoire pédiatrique, Hôpital pour enfants malades.


Matériel et méthodes

Disponibilité des matériaux

De plus amples informations et demandes de ressources et de réactifs doivent être adressées à Chiara Francavilla et seront traitées par courrier électronique à l'adresse [email protected] .

Tableau des réactifs et des outils

Ces informations sont fournies dans un tableau séparé des réactifs et des outils.

Réactif ou ressource La source Identifiant
Anticorps
Anticorps de lapin anti-Phospho-EGF Receptor (Tyr1068) Technologie de signalisation cellulaire 2234S
Phospho-p38 MAPK monoclonal de souris (Thr180/Tyr182) (28B10) Technologie de signalisation cellulaire 9216S
Lapin polyclonal CDK1 (phospho T161) Abcam ab47329-100ug
Lapin polyclonal CDK1 Abcam ab131450-100ug
Anticorps monoclonal de souris FIP1/RCP Bio Techne NBP2-20033
Souris monoclonale ERK 1/2 Biotechnologie de Santa Cruz sc-135900
γ-Tubuline monoclonale de souris Sigma-Aldrich T5326
Vinculine monoclonale de souris Sigma Aldrich V9264-200UL
Lapin polyclonal pEGFR Thr669 Technologie de signalisation cellulaire 3056s
Lapin monoclonal pEGFR Thr669 Technologie de signalisation cellulaire 8808s
Lapin monoclonal p44/42 MAPK (Erk1/2) (137F5) Technologie de signalisation cellulaire 4695S
GAPDH monoclonal de souris Abcam ab8245-100ug
EGFR monoclonal de souris (Ab-1) Merck GR01L-100UG
EGFR polyclonal de lapin millipore 06-847
Anticorps monoclonal de lapin FGFR1 D8E4 Technologie de signalisation cellulaire 9740
Lapin polyclonal SH3BP4 Abcam PLC ab106609-100ug
Récepteur FGF monoclonal de lapin 2 (D4L2V) Technologie de signalisation cellulaire 23328S
Lapin monoclonal P38 Technologie de signalisation cellulaire 9212
GFP monoclonale de lapin Technologie de signalisation cellulaire 2956
Peroxydase-AffiniPure F(ab')2 Fragment IgG de chèvre anti-souris (H + L) (min X Hu, Bov, Hrs Sr Prot) Stratetech 115-036-062-JIR-0,5 ml
Peroxydase-AffiniPure F(ab')2 Fragment IgG de chèvre anti-lapin (H + L) (min X Hu Sr Prot) Stratetech 111-036-045-JIR-0,5 m
Souris monoclonale à EEA1 BD Biosciences 610457
Anticorps secondaire IgG (H + L) de chèvre anti-lapin, conjugué Alexa Fluor® 488 Invitrogène A11034
Anticorps secondaire IgG (H + L) de chèvre anti-souris, conjugué Alexa Fluor® 488 Invitrogène A11001
Anticorps secondaire IgG (H + L) de chèvre anti-lapin, conjugué Alexa Fluor® 568 Invitrogène A11011
Anticorps secondaire IgG (H + L) anti-souris d'âne, conjugué Alexa Fluor® 647 Invitrogène A31571
Anticorps secondaire IgG (H + L) anti-lapin d'âne, conjugué Alexa Fluor® 647 Invitrogène A31573
Souches bactériennes et virales
NEB® 10-beta E. coli compétent (haute efficacité) Biolabs de la Nouvelle-Angleterre Chat. N° : C3019H
Échantillons biologiques
Produits chimiques, peptides et protéines recombinantes
Pancréas porcin trypsine (qualité protéomique) Sigma-Aldrich T6567
Lysyl Endopeptidase Produits chimiques FUJIFILM Wako 2541
Billes TiO « Titansphères » GL Sciences 5020-75000
Gel dégradé pré-coulé : Nu-PAGE 4-12% Bis-Tris Gel 1.0mm 10 puits Invitrogène NP0321BOX
Cartouches Sep-Pak Classic C18 Eaux WAT051910
Disque d'extraction en phase solide « Empore » C18 (Octadecyl) 3 M Technologies Agilent 2215
Disque d'extraction en phase solide « Empore » C8 (Octyl) 3 M Technologies Agilent 2214
L-ARGININE : HCL Laboratoires d'isotopes de Cambridge CLM-2265-H-0.25
L-ARGININE : HCL Laboratoires d'isotopes de Cambridge CNLM-539-H-0.5
L-ARGININE : HCL Sigma-Aldrich A6969
L-LYSINE : 2HCL Laboratoires d'isotopes de Cambridge DLM-2640-0.5
L-LYSINE : 2HCL Laboratoires d'isotopes de Cambridge CNLM-291-H-0.5
L-LYSINE : 2HCL Sigma-Aldrich L8662
Acide 2,5-dihydroxybenzoïque Sigma-Aldrich 85707
Médium RPMI 1640 pour SILAC ThermoFisher Scientifique 88365
Réactif TRIzol™ ThermoFisher Scientifique Chat. N° 15596026
DIHYDROETHIDIUM Cambridge Biosciences 12013-5mg-CAY
Hoechst 33342 Biolabs de la Nouvelle-Angleterre 4082S
Réactif de transfection Lipofectamine RNAiMAX ThermoFisher Scientifique 10601435
Réactif de transfection lipofectamine Technologies de la vie 18324020
Réactif de transfection FuGENE HD Promega France E2311
Solution de pyruvate de sodium 100mM (100ml) Sigma-Aldrich S8636-100ML
Solution de cristal violet Sigma-Aldrich V5265-250ML
Film IRM Carestream Kodak BioMax Kodak Z350370-50EA
Capuchons plats 8 bandes Xtra-Clear Laboratoires vedettes I1400-0900-C
Plaque PCR 96 puits, sans jupe, profil bas, naturel Laboratoires vedettes E1403-0200-C
Supplément Glutamax Moyen RPMI 1640 (500 ml) Gibco 61870010
Système ReliaPrep RNA Cell Miniprep BEC Z6011
Large gamme standard de protéines précolorées BEC P7712S
Large gamme standard de protéines précolorées Sigma-Aldrich SDS7B2
PURELINK RAPIDE MINI BEC? K210010
ADN ligase T4 20 000 u BEC? M0202S
DMEM HEPES à haute teneur en glucose sans glutamine et pyruvate de sodium Sigma-Aldrich D6171-6X500ML
Milieu DMEM AQ Sigma-Aldrich D0819-500ml
RPMI 1640 avec L-Glutamine-Bicarbonate Sigma-Aldrich R8758-6X500ML
Mastermix 2x haute fidélité Q5 BEC M0492S
Mélange Nutritif F12 JAMBON Sigma-Aldrich N6658-500ML
EGF humain (sans animaux) PeproTech AF-100-15-1000
MARQUEUR DE POIDS MOLÉCULAIRE PRÉTEINT, MW 2 Sigma-Aldrich SDS7B2-1VL
MG132 Fisher Sientific 15465519
HYPERFILM ECL 18X24CM VWR International Ltd 28-9068-37
Albumine, fraction bovine V (BSA), 100 grammes N° de cat : A30075-100,0 Biolaboratoires Melford Ltée A30075-100.0
Réactif de Bradford Bio-Rad 5000205
Clarté ECL Bio-Rad 1705061
Mélange de transcription inverse GoScript, amorces aléatoires Promega A2801
Comprimés d'inhibiteur de protéase Pierce-20 comprimés Technologies de la vie A32963
MEMBRANE PROTRAN 0,45uM NC 300MMX4 M VWR 10600002
qPCRBIO SyGreen Mix Séparé-ROX biosystèmes pcr PB20.14-50
ProLong Diamond Antifade Mountant-2 mL Technologies de la vie P36965
ExoSAP-IT Technologies de la vie 78250.40.ul
DMSO Sigma-Aldrich 276855-250ml
ACÉTONITRILE VWR International Ltd 1.00030.2500
HÉPARINE SODIQUE EN CULTURE DE CELLULES TESTÉE Sigma-Aldrich H3149-100KU
Escorte IV SLS L3287-1ML
Pénicilline-Streptomycine (10 000 U/mL) Technologies de la vie Ltée 15140122
EGF humain Sigma-Aldrich E9644-.2MG
TGFα humain Pepro Tech Limitée 100-16A
FGF1 humain Pepro Tech Limitée 100-17A-50
FGF7 humain Francavilla et al 2013 CP : Pr Olsen
FGF3 humain Bio Techne 1206-F3-025
FGF10 humain Francavilla et al 2013 CP : Pr Olsen
Enkamin-E Pepro Tech Limitée A14-529EP
PD173074 Selleckchem S1264
AG1478 Technologies de signalisation cellulaire 9842
U2106 Technologies de signalisation cellulaire 9903
MEK162 APEXBIO A1947
BMS582949 Selleck Chem S8124
Collagène I, HC, queue de rat, 100 mg Corning 354249
FIBRONECTINE DE PLASMA BOVIN Sigma F1141-1MG
Poudre DMEM, haute teneur en glucose Thermo Fisher 52100021
Sérum fœtal bovin, origine sud-américaine Technologies de la vie 10270106
MEMBRANE TW PC, 6,5 MM, 8,0 UM Inserts Transwell Sigma Aldrich CLS3422-48EA
Colorant permanent des cellules Calcéine AM Fisher scientifique C1430
Acide acétique glacial (qualité HPLC) Fisher Scientific Royaume-Uni 10060000
Acide formique (qualité HPLC) Sigma-Aldrich 5438040250
Acide trifluoroacétique (qualité de spectroscopie) Sigma-Aldrich 1082621000
Dispas Technologies des cellules souches 7913
Matrigel Corning 354230
DAPI (4',6-Diamidino-2-Phénylindole, Dichlorhydrate) Technologie de la vie D1306
Transferrine de sérum humain, conjugué Alexa Fluor™ 647 Invitrogène T23366
Transferrine de sérum humain, conjugué de tétraméthylrhodamine Invitrogène T2872
Essais commerciaux critiques
Kit d'imagerie Click-iT EdU Alexa Fluor 488 Kit-1 Technologies de la vie C10337
Kit de détection PCR Venor®GeM Classic Mycoplasma (100 tests) Cambridge Biosciences 11-1100
Kit de synthèse d'ADNc premier brin ProtoScript II Biolabs de la Nouvelle-Angleterre E6560L
Système ReliaPrep RNA Cell Miniprep Promega Z6011
Kit de dissociation tumorale Miltenyi Biotec 130-095-929
Kit PCR et gel Isolate II Ligne bio BIO-52059
Mini kit plasmide Isolate II Ligne bio BIO-52056
Données déposées
Données brutes (MS) Ce papier http://proteomecentral.proteomexchange.org/cgi/GetDataset (identifiant de l'ensemble de données PXD018184)
Modèles expérimentaux : lignées cellulaires
MCF-7 LGC ATCC® HTB-22
MDA-MB-415 LGC ATCC® HTB-24
BT20 LGC ATCC® HTB-19
HCC1937 LGC ATCC® CRL-2336
T47D LGC ATCC® HTB-133
BT549 LGC ATCC® HTB-122
Modèles expérimentaux : organismes/souches
BB6RC37 Eyre et al ( 2016 ) PI : R. Clarke
Oligonucléotides
CONTRLE NÉGATIF ​​SIRNA UNIV #2 Sigma-Aldrich SIC002
GGAGAUGAAAGUGUCAGCCGAGAUA Invitrogène SH3BP4HSS119149
CCCAGGAUCUCAAGGUCUGUAUGUU Invitrogène SH3BP4HSS119150
CCUGAUUGACCUGAGCGAAGGGUUU Invitrogène SH3BP4HSS119151
GGUCCUCAAACAGAAGGAAACGAUA Invitrogène RAB11FIP1HSS149439
GAAGACUACAUUGACAACCUGCUUG Invitrogène RAB11FIP1HSS149440
UCCGCAUCCCGACUCAGGUUGGCAA Invitrogène RAB11FIP1HSS149441
CGGAAUAGGUAUUGGUGAAUUUAAA Invitrogène EGFRHSS176346 (G01)
CCUAUGCCUUAGCAGCAGUCUUAUCUAA Invitrogène EGFRHSS103116 (G06)
CCCGUAAUUAUGUGGUGACAGAUCA Invitrogène EGFRHSS103114 (G09)
CCN1 F- GGTCAAAGTTACCGGGCAGT R- GGAGGCATCGAATCCCAGC Dans la maison n / A
DUSP1 F- GCCTTGCTTACCTTATGAGGAC R-GGGAGAGATGATGCTTCGCC Dans la maison n / A
FOS F- AGGAGGGAGCTGACTGATACACT R- TTTCCTTCTCCTTCAGCAGGTT Dans la maison n / A
JUNB F- ACGACTCATACACAGCTACGG R- GCTCGGTTTCAGGAGTTTGTAGT Dans la maison n / A
TIMP3 F- CATGTGCAGTACATCCATACGG R- CATCATAGACCGCGACCTGTCA Dans la maison n / A
EGR1 F- GAGAAGGTGCTGGTGGAGAC R- CACAAGGTGTTGCCACTGTT Dans la maison n / A
BCL10 F- GTGAAGAAGGACGCCTTAGAAA R- TCAACAAGGGTGTCCAGACCT Dans la maison n / A
CTGF F- CAGCATGGACGTTCGTTCTG R- AACCACGGTTTGGTCCTTGG Dans la maison n / A
MCL1 F-ATCTCTCGGTACCTTCGGGAGC R- GCTGAAAACATGGATCATCACTCG Dans la maison n / A
DUSP6 F- CCGCAGGAGCTATACGAGTC R- CGTAGAGCACCACTGTGTCG Dans la maison n / A
ABHD5 F- GCTGCTGCTTACTCGCTGAA R- TCTGATCCAAACTGGAATTGGTC Dans la maison n / A
KDM6B F- CACCCCAGCAAACCATATTATGC R- CACACAGCCATGCAGGGATT Dans la maison n / A
MXD1 F- CGTGGAGAGCACGGACTATC R- CCAAGACACGCCTTGTGACT Dans la maison n / A
NDRG1 F CTCCTGCAAGAGTTTGATGTCC - R- TCATGCCGATGTCATGGTAGG Dans la maison n / A
SPRY2 F- CCTACTGTCGTCCCAAGACCT R- GGGGCTCGTGCAGAAGAAT Dans la maison n / A
ID4 F- TGCCTGCAGTGCGATATGAA R- GCAGGTCCAGGATGTAGTCG Dans la maison n / A
FGFR2b F- AACGGGAAGGAGTTTAAGCAG R- CTCGGTCACATTGAACAGAG Dans la maison n / A
BETA ACTIN F- TGGAACGGTGAAGGTGACAG R- AACAACGCATCTCATATTTGGAA Dans la maison n / A
GAPDH F- CAATGACCCCTTCATTGACC R- GACAAGCTTCCCGTTCTCAG Dans la maison n / A
ADN recombinant
EGFR (pRK5-EGFR) Addgene Plasmide #65225
EGFRT693A Mutagenèse ci-dessus
eGFP-Rab11 Addgene Plasmide #12674
eGFP-Rab11_S52N Mutagenèse ci-dessus
Dynamin_K44a-eGFP Mutagenèse du plasmide Addgene Plasmide # 34680
HA-FGFR1c Francavilla et al ( 2009 ) CP : Dr Cavallaro
HA-FGFR2b Francavilla et al ( 2013 ) CP : Pr Olsen
HA_FGFR2b_Y656F/Y657F Francavilla et al ( 2013 ) CP : Pr Olsen
HA-FGFR4 cloné à l'aide d'ADNc humain avec des amorces F-GGGGCCCAGCCGGCCAGACTGGAGGCCTCTGAGGAAGTGGAGCTTGAGCC R -GTCGACCTGCAGTGTCTGCACCCCAGACCCGAAGGGGAAGGAGCTGGATCC Généré pour cette étude n / A
Logiciels et algorithmes
Fidji - Image J version : 1.52p Schindelin et al ( 2012 ) https://imagej.net/Fiji
GraphPad Prism version 8.0.0 Logiciel GraphPad www.graphpad.com
MaxQuant version 1.5.6.5 Cox et Mann (2008) http://www.coxdocs.org/doku.php?id=maxquant:start
WebGestalt 2019 Liao et al (2019) http://www.webgestalt.org/
Persée versions 1.6.5.0 ou 1.6.2.1. : Tyanova et al (2016) http://www.coxdocs.org/doku.php?id=maxquant:start
Cytoscape version 3.7.2 Shannon et al ( 2003 ) https://www.cytoscape.org
CHAINE version 11 Szklarczyk et al ( 2019 ) https://string-db.org/
Cadre R Équipe de base R ( 2018 ) https://www.r-project.org/
Autre
Microscope confocal Leica Sp8 inversé Lécia
Machine qPCR Mx3000P Agilent
LC à séparation rapide UltiMate® 3000 Dionex
QE-HF LC-MS/MS Thermo Fisher Scientific

Méthodes et protocoles

Modèles expérimentaux

Culture cellulaire et marquage SILAC

Des lignées cellulaires de cancer du sein humain ont été achetées auprès de l'ATCC, authentifiées par une analyse à répétition en tandem (STA) de 21 marqueurs par Eurofins Genomics, vérifiées mensuellement pour les mycoplasmes via un test de détection par PCR (Venor®GeM—Cambio) et cultivées dans les milieux indiqués supplémenté avec 2 mM de L-glutamine et 100 U/ml de pénicilline, 100 g/ml de streptomycine et 10 % de sérum bovin fœtal. MCF-7 a été cultivé dans DMEM/F12. MDA-MB-415 et BT20 ont été cultivés dans du DMEM. HCC1937, T47D et BT549 ont été cultivés dans du RPMI. Du pyruvate de sodium 1 mM a été ajouté au T47D.

Pour la spectrométrie de masse quantitative, les cellules BT549 ou T47D ont été marquées dans du SILAC RPMI (PAA Laboratories GmbH, Germany) additionné de 10% de sérum bovin foetal dialysé (Sigma), 2 mM de glutamine (Gibco), 100 U/ml de pénicilline et 100 µg/ml streptomycine pendant 15 jours pour assurer une incorporation complète des acides aminés, ce qui a été vérifié par analyse MS. Trois populations cellulaires ont été obtenues : une marquée avec des variants naturels des acides aminés (marqueur léger Lys0, Arg0), la seconde avec des variants moyens des acides aminés (marqueur moyen L-[13C6] Arg (+6) et L-[2H4 ]Lys (+4) Lys4/Arg6) et le troisième avec des variants lourds des acides aminés (marquage lourd L-[13C6,15N4]Arg (+10) et L- [13C6,15N2]Lys (+8) Lys8 /Arg10).Les acides aminés légers provenaient de Sigma, tandis que leurs variantes moyennes et lourdes provenaient de Cambridge Isotope Labs (Massachusetts, US).

Culture organoïde du cancer du sein et isolement des protéines

Les organoïdes ont été générés à partir d'une tumeur PDX du cancer du sein triple-négative, BB6RC37 (Eyre et al, 2016). Les tumeurs ont été hachées et digérées à l'aide d'un kit de dissociation des tumeurs (Miltenyi Biotec) sur un agitateur orbital à 37°C pendant 1 à 2 h. Les cellules ont été successivement tendues à travers des mailles de 100 µm et 40 µm. 50 000 cellules ont été remises en suspension dans 50 µl de Matrigel à facteur de croissance froid réduit (Corning 354230), placées sous forme de dômes dans une plaque à 24 puits pendant 30 min et cultivées à 37°C dans des milieux tels que définis par (Sachs et al, 2018). Les organoïdes ont été cultivés dans des milieux avec ou sans FGF7/10 pendant 14 jours, et EGF/Heregulin ont été retirés des milieux 24 h avant l'obtention des lysats. Les lysats ont été préparés en désagrégeant mécaniquement les dômes et en digérant le Matrigel pendant 1 h en utilisant une dispase à 37°C (Stem Cell Technologies, 7913). Les cellules ont été lavées dans du PBS et remises en suspension dans du tampon de lyse comme décrit précédemment (Santiago-Gomez et al, 2019 ).

Phosphoprotéomique quantitative

Conception expérimentale et préparation des échantillons

TPA1: pour chaque lignée cellulaire et chaque stimulus, nous avons analysé les doublons pour chaque point de temps, en considérant à la fois 1 et 8 min. points temporels représentatifs de la signalisation précoce. Par conséquent, nous avons comparé quatre échantillons sans étiquette pour chaque stimulus dans chaque lignée cellulaire (ensembles de données EV1 et EV2). Le culot cellulaire a été dissous dans du tampon de dénaturation (urée 6 M, thiourée 2 M dans HEPES 10 mM pH 8). Nous avons obtenu 1 mg de protéines de chaque échantillon. Les cystéines ont été réduites avec du dithiothréitol 1 mM (DTT) et alkylées avec du chloroacétamide (CAA) 5,5 mM. Les protéines ont été digérées avec de l'endoprotéinase Lys-C (Wako, Osaka, Japon) et de la trypsine modifiée de qualité séquençage (grade de séquençage modifié, Sigma) suivie d'une trempe avec de l'acide trifluoroacétique (TFA) à 1 %. Les peptides ont été purifiés en utilisant des cartouches Sep-Pak C18 en phase inverse (Waters, Milford, MA) et élues avec 50 % d'acétonitrile (ACN). Après avoir éliminé l'ACN par un concentrateur sous vide à 60°C, les peptides ont été mis en suspension dans un tampon d'immunoprécipitation phosphopeptide (50 mM de MOPS pH 7,2, 10 mM de phosphate de sodium, 50 mM de NaCl) et dissous pendant une nuit. Les peptides clarifiés ont été transférés dans un nouveau tube contenant des billes d'anticorps de tyrosine phosphorylée immobilisées (pY100-AC, Cell Signaling Technologies) et incubés pendant deux heures à 4°C. Après cinq lavages avec du tampon d'immunoprécipitation suivis de deux lavages avec 50 mM de NaCl, les peptides enrichis ont été élues des billes trois fois avec 50 L de 0,1% de TFA, chargés sur des pointes C18 STAGE et élues des pointes STAGE avec 20 L de 40% ACN suivi de 10 L 60% ACN et réduit à 5 L par SpeedVac et 5 μL 0,1% d'acide formique (FA) 5% ACN ajouté. Les peptides du surnageant ont été purifiés à l'aide de cartouches Sep-Pak C18 en phase inversée (Waters, Milford, MA) et élués avec 50 % d'ACN et enrichis en peptides phosphorylés contenant de la sérine et de la thréonine phosphorylée, par chromatographie Titansphere. Six ml de TFA à 12 % dans de l'ACN ont été ajoutés aux peptides élués et ensuite enrichis avec des billes de TiO2 (5 µm, GL Sciences Inc., Tokyo, Japon). Les billes ont été mises en suspension dans 20 mg/mL d'acide 2,5-dihydroxybenzoïque (DHB), 80 % d'ACN et 6 % de TFA et les échantillons ont été incubés dans un rapport échantillon/bille de 1:2 (p/p) en mode batch pendant 15 min avec rotation. Après 5 min de centrifugation, le surnageant a été récupéré et incubé une seconde fois avec une dilution au double de la suspension de billes précédente. Les billes ont été lavées avec 10 % d'ACN, 6 % de TFA suivi de 40 % d'ACN, 6 % de TFA et recueillies sur des embouts C8 STAGE et enfin lavées par 80 % d'ACN, 6 % de TFA. L'élution des peptides phosphorylés a été effectuée avec 20 ul de NH3 à 5 % suivis de 20 ul de NH3 à 10 % dans 25 % d'ACN, qui ont été évaporés jusqu'à un volume final de 5 ul dans un vide rapide. Les peptides phosphorylés concentrés ont été acidifiés avec l'ajout de 20 L de TFA à 0,1 %, 5 % d'ACN et chargés sur des pointes C18 STAGE. Les peptides ont été élués des pointes STAGE avec 20 L d'ACN à 40 % suivis de 10 L d'ACN à 60 % et d'ACN et réduits à 5 L par SpeedVac et 5 L à 0,1 % de FA, 5 % d'ACN ajoutés.

Une petite quantité des peptides élués (1%) a été prélevée pour l'analyse du protéome avant enrichissement en peptides phosphorylés : après évaporation sous vide speed, 40 l de 0,1% de TFA, 5% d'ACN ont été ajoutés suivi d'une analyse MS.

TPA2: nous avons analysé des triplicats sans marqueur pour chaque condition, T47D appauvri ou non en TTP ou RCP et stimulé ou non avec FGF10. Les cellules ont été lavées avec du PBS et lysées à 4°C dans du tampon de lyse triton glacé à 1 % complété par un comprimé d'inhibiteur de protéase Pierce (Life Technologies) et des inhibiteurs de phosphatase : 5 nM de Na3VO4, 5 mM de NaF et 5 mM de -glycérophosphate. Les protéines ont été précipitées pendant une nuit à -20°C dans un excès de quatre fois d'acétone glacée. Les protéines précipitées à l'acétone ont été solubilisées dans un tampon de dénaturation (10 mM HEPES, pH 8,0,6 M urée, 2 M thiourée) et 5 mg de protéines ont été réduits, alkylés et digérés, comme décrit ci-dessus. Toutes les étapes ont été réalisées à température ambiante. Le mélange de peptides a été dessalé et concentré sur une cartouche C18-Sep-Pak, élué et enrichi avec des billes de Ti02, comme décrit ci-dessus.

TPA3: nous avons analysé des doublons de BT549 marqué au SILAC, transfectés et traités comme décrit dans la figure 2A. Nous avons suivi la même procédure que celle décrite pour le TPA2 avec la seule différence que 5 mg de chaque lysat marqué au SILAC ont été mélangés en quantité égale avant la digestion et la chromatographie sur TiO2.

Cellules T47D exprimant EGFR et EGFR_T693A: nous avons analysé des doublons de T47D marqué au SILAC transfectés et traités comme décrit dans la figure 6A. Nous avons suivi la même procédure décrite pour TPA1 avec la seule différence que 5 mg de chaque lysats marqués SILAC ont été mélangés en quantités égales avant la digestion et l'enrichissement en tyrosine phosphorylée suivi de la chromatographie TiO2 et de la purification des peptides.

Spectrométrie de masse

Les peptides purifiés ont été analysés par LC-MS/MS en utilisant un UltiMate® 3000 Rapid Separation LC (RSLC, Dionex Corporation, Sunnyvale, CA) couplé à un spectromètre de masse QE-HF (Thermo Fisher Scientific, Waltham, MA). La phase mobile A était de 0,1 % FA dans l'eau, et la phase mobile B était de 0,1 % FA dans ACN et la colonne était une colonne analytique de 75 mm x 250 m de diamètre intérieur 1,7 M CSH C18 (Waters). Une aliquote de 1 l de l'échantillon (pour l'analyse du protéome) ou une aliquote de 3 l a été transférée dans une boucle de 5 l et chargée sur la colonne à un débit de 300 nl/min à 5% B pendant 5 et 13 min, respectivement. La boucle a ensuite été déconnectée et le débit a été réduit de 300 nl/min à 200 nl/min en 1 min, et à 7 % de B. Les peptides ont été séparés en utilisant un gradient qui est passé de 7 % à 18 % de B en 64 min., puis de 18% à 27% B en 8 min. et enfin de 27% B à 60% B en 1 min. La colonne a été lavée à 60% B pendant 3 min. puis rééquilibré pendant 6,5 min supplémentaires. A 85 min, le débit a été augmenté à 300 nl/min jusqu'à la fin de l'analyse à 90 min. Les données de spectrométrie de masse ont été acquises de manière dirigée pendant 90 min en mode positif. Les peptides ont été sélectionnés pour la fragmentation automatiquement par analyse dépendante des données sur la base du top 8 (analyse du phosphoprotéome) ou du top 12 (analyse du protéome) avec m/z compris entre 300 et 1750Th et un état de charge de 2, 3 ou 4 avec une dynamique exclusion fixée à 15 s. La résolution MS a été fixée à 120 000 avec une cible AGC de 3e6 et un temps de remplissage maximum fixé à 20 ms. La résolution MS2 a été fixée à 60 000, avec une cible AGC de 2e5 et un temps de remplissage maximum de 110 ms pour les méthodes Top12, et 30 000, avec une cible AGC de 2e5 et un temps de remplissage maximum de 45 ms pour l'analyse Top8. La fenêtre d'isolement était de 1,3Th (2,6 Th pour les échantillons marqués SILAC), et l'énergie de collision était de 28.

Analyse des fichiers bruts

Les données brutes ont été analysées par la suite logicielle MaxQuant (Cox & Mann, 2008) (https://www.maxquant.org version 1.5.6.5) en utilisant le moteur de recherche intégré Andromeda (Cox et al, 2011). Les protéines ont été identifiées en recherchant les listes de pics HCD-MS/MS par rapport à une version cible/leurre de la base de données humaine UniProt Knowledgebase qui se composait des ensembles complets de protéomes et d'isoformes (v.2016 https.//uniprot.org/proteomes/UP000005640_9606) complété par des contaminants couramment observés tels que la trypsine porcine et les protéines de sérum bovin. Les spectres de masse en tandem ont été initialement appariés avec une tolérance de masse de 7 ppm sur les masses précurseurs et de 0,02 Da ou 20 ppm pour les ions fragments. La carbamidométhylation de la cystéine a été recherchée en tant que modification fixe. La N-acétylation des protéines, la N-pyro-glutamine, la méthionine oxydée et la phosphorylation de la sérine, de la thréonine et de la tyrosine ont été recherchées en tant que modifications variables. La N-acétylation des protéines, la méthionine oxydée et la désamidation de l'asparagine et de la glutamine ont été recherchées en tant que modifications variables pour les expériences sur le protéome. Pour la quantification des échantillons marqués SILAC, la lysine et l'arginine marquées ont été spécifiées comme modification fixe ou variable, en fonction des connaissances préalables sur l'ion parent (identification du triplet MaxQuant SILAC). Dans toutes les autres expériences, des paramètres sans marqueur ont été utilisés comme décrit (Cox et al, 2014). Le taux de fausses découvertes a été fixé à 0,01 pour les peptides, les protéines et les sites de modification. La longueur minimale du peptide était de six acides aminés. Les probabilités de localisation du site ont été calculées par MaxQuant en utilisant l'algorithme de notation PTM (Olsen et al, 2006). Les ensembles de données ont été filtrés par probabilité d'erreur postérieure pour obtenir un taux de fausses découvertes inférieur à 1 % pour les peptides, les protéines et les sites de modification. Seuls les peptides avec un score Andromeda > 40 ont été inclus.

Données et analyse statistique

Toutes les analyses statistiques et bioinformatiques ont été effectuées à l'aide du logiciel gratuit Perseus, version 1.6.5.0 ou 1.6.2.1. (Tyanova & Cox, 2018 ), R framework (R Core Team, 2018), Bioconductor R-package LIMMA (Bolstad et al, 2003 ), WebGestalt (Liao et al, 2019 ), STRING (Szklarczyk et al, 2019 ), Cytoscape (version 3.7.2) (Shannon et al, 2003). Toutes les intensités peptidiques mesurées ont été normalisées à l'aide de la fonction « normalizeQuantiles » du Bioconductor R-package LIMMA, qui normalise les intensités peptidiques de sorte que chaque quantile de chaque échantillon est défini sur la moyenne de ce quantile dans l'ensemble de données, ce qui entraîne des distributions d'intensité peptidique qui sont empiriquement identiques. Chaque ensemble de données a été normalisé individuellement. L'analyse des données ultérieures a été effectuée à l'aide de Microsoft Office Excel, R et Perseus. Pour les ensembles de données SILAC, nous avons utilisé les ratios SILAC normalisés des fichiers txt de sortie MaxQuant. Seuls les peptides avec des probabilités de localisation supérieures à 0,75 (classe I, indiqué dans les ensembles de données EV1, EV3–EV6 Olsen et al, 2006 ) ont été inclus dans l'analyse bioinformatique en aval. La corrélation de Pearson a été calculée dans R. Pour TPA1, nous imputons les valeurs manquantes à l'aide des paramètres par défaut de Perseus, nous avons soustrait le contrôle des valeurs d'intensité log afin de pouvoir comparer toutes les lignées cellulaires les unes par rapport aux autres et nous avons utilisé la médiane pour chaque condition. Le regroupement hiérarchique basé sur la corrélation a été effectué après un test ANOVA multi-échantillons avec des paramètres par défaut dans Perseus. Pour TPA2, nous avons calculé la médiane, puis considéré uniquement les lignes avec quatre valeurs valides, suivies d'un regroupement hiérarchique basé sur la distance euclidienne dans Persée. Pour TPA3 et l'ensemble de données EGFR/EGFR_T693A T47D, nous avons imputé les valeurs manquantes à l'aide des paramètres par défaut de Persée, puis calculé la médiane, suivie d'un regroupement hiérarchique basé sur la distance euclidienne dans Persée. Les clusters utilisés dans l'analyse de suivi ont été définis par Persée et vérifiés manuellement.

L'enrichissement des termes KEGG ou GO a été effectué dans WebGestalt en utilisant les paramètres par défaut de l'ORA, et les termes considérablement surreprésentés dans les données ont été représentés dans des diagrammes à barres. La relation des gènes avec d'autres maladies était basée sur la base de données MALADIES (Pletscher-Frankild et al, 2015 ).

Tous les réseaux d'interactions protéiques ont été obtenus à l'aide de la base de données d'interactions protéiques STRING en utilisant un niveau de confiance élevé et des interactions dérivées des canaux de preuves Experiments et Databases. La visualisation des données a été réalisée à l'aide du logiciel Cytoscape. Le diagramme de Venn a été créé à l'aide de l'outil Web http://bioinformatics.psb.ugent.be/cgi-bin/liste/Venn/calculate_venn.htpl.

Dosages biochimiques

Isolement d'ARN et analyse PCR en temps réel

L'ARN des lignées cellulaires a été isolé avec TRIZOL® (Invitrogen). Après extraction au chloroforme et centrifugation, 5 µg d'ARN ont été traités à la DNase à l'aide du RNase-Free DNase Set (Qiagen) et 1 µg d'ARN traité à la DNase ont ensuite été prélevés pour la synthèse d'ADNc à l'aide du kit de synthèse d'ADNc premier brin Protoscript I (New England Biolabs). Les gènes sélectionnés ont été amplifiés par PCR quantitative en temps réel (RT-qPCR) à l'aide de Sygreen (PCR Biosystems). L'expression relative a été calculée à l'aide de la méthodologie CT delta-delta, et la bêta-actine a été utilisée comme gène d'entretien de référence. Les séquences des amorces utilisées peuvent être trouvées dans le tableau des réactifs ci-joint. La machine qPCR utilisée était Applied Biosystems MX300P.

Transfection et interférence ARN

Toutes les transfections ont été réalisées dans un milieu de sérum réduit Gibco opti-MEM glutamax (Thermo Fisher Scientific). Pour l'interférence ARN, toutes les cellules ont été transfectées à l'aide de Lipofectamine RNAiMax (Thermo Fisher Scientific), selon les instructions du fabricant. Des oligonucléotides d'ARNsi furtifs double brin validés ont été utilisés pour l'interférence ARN. SiRNA Universal Negative Control #2 (Sigma-Aldrich) a été utilisé comme contrôle dans toutes les expériences d'interférence ARN. Les cellules BT549 et BT20 ont été transfectées à l'aide de Lipofectamine 3000 (Thermo Fisher Scientific) selon les instructions du fabricant, 24 h après la transfection par interférence ARN, le cas échéant. Les cellules T47D ont été transfectées en utilisant Escort IV selon les instructions du fabricant, comme ci-dessus. Les dosages ont été effectués 36 h après la transfection, comme décrit précédemment (Francavilla et al, 2016). Lorsque les dosages ont été effectués plus de 36 h après la transfection, l'ARNi et l'expression ont été évalués au moment du dosage pour confirmer l'expression.

Lyse cellulaire, immunoprécipitation des protéines et western blot

Les cellules ont été privées de sérum pendant une nuit dans un milieu sans sérum et stimulées pendant les moments indiqués avec 100 ng/ml de FGF7, FGF10, EGF ou TGFα. Les ligands ont été renouvelés toutes les 24 h pour une stimulation à long terme (24 à 72 h). Lorsque cela est indiqué, les cellules ont été pré-incubées pendant 2 h avec 100 nM de PD173074, 500 nM d'AG1478, 20 M d'U1206, 1 M de MEK162 ou 10 M de BMS582949. Les cellules témoins ont été pré-incubées avec du DMSO seul. Après stimulation, l'extraction cellulaire et l'immunotransfert ont été effectués comme décrit précédemment (Francavilla et al, 2016). Les protéines ont été résolues par SDS-PAGE et transférées sur des membranes de nitrocellulose (Protran, Biosciences). Les protéines d'intérêt ont été visualisées à l'aide d'anticorps spécifiques, suivis d'anticorps secondaires conjugués à la peroxydase et d'un kit de chimiluminescence amélioré (Amersham Biosciences). Les transferts ont été visualisés soit en utilisant une exposition sur film, soit avec le système d'imagerie moléculaire en gel Universal Hood II (Bio-Rad). Chaque expérience a été répétée au moins trois fois et a produit des résultats similaires.

L'immunoprécipitation du FGFR2 à partir d'extraits cellulaires a été réalisée comme décrit précédemment (Francavilla et al, 2016), à l'aide d'anti BEK (Santa Cruz Biotechnology, sc-121). Chaque expérience a été répétée au moins trois fois et a produit des résultats similaires.

Essais de biotinylation

Des expériences de biotinylation pull down ont été réalisées comme décrit précédemment (Lobingier et al, 2017). Brièvement, des expériences de biotinylation ont été réalisées en transfectant des constructions GFP-Rab11-APEX2 dans 2 millions de cellules étalées dans des boîtes de 10 cm. Les cellules ont été pré-incubées (40 min) avec du phénol de biotine (Iris Biotech), après stimulation avec des ligands, du peroxyde d'hydrogène (Sigma-Aldrich) a été ajouté pendant 1 min avant une trempe avec du Trolox (Sigma-Aldrich) et de l'ascorbate de sodium (VWR) pendant lyse glaciale. Un pull down RT de 2 heures avec des billes de streptavidine a ensuite été effectué en exécutant le surnageant contre les protéines liées.

Essais de prolifération

Test de prolifération de cellules d'inucyte

Les lignées cellulaires indiquées ont été ensemencées dans des plaques à 24 puits à une densité de 15 000 à 20 000 cellules par puits, selon le taux de croissance et la conception de l'expérience. Après que les cellules de placage aient été affamées et stimulées avec les ligands indiqués toutes les 24 h et imagées toutes les heures à l'aide de l'Incucyte ZOOM (Essen Bioscience), les images en contraste de phase ont été analysées pour détecter la prolifération cellulaire basée sur la confluence cellulaire. Et la valeur de confluence moyenne sur 4 h a été utilisée pour déterminer la confluence de départ à partir de laquelle un changement de croissance relatif a été calculé. L'analyse statistique a été effectuée au point final à travers les répétitions, comme indiqué dans les légendes de la figure.

Violet cristallisé

Les cellules indiquées ont été colorées après expérimentation en étant fixées avec du cristal violet à 0,5 % p/v (Sigma) dans du paraformaldéhyde/PBS à 4 % p/v pendant 30 min. Les cellules fixées ont ensuite été solubilisées dans du SDS/PBS à 2 % p/v et l'absorbance a été mesurée à 595 nm en utilisant un lecteur de microplaques Synergy H1 (BioTek). L'analyse statistique a été effectuée au point final à travers les répétitions, comme indiqué dans les légendes de la figure.

Incorporation EdU

Les cellules indiquées ont été marquées avec 20 uM de 5-éthynyl-2'-désoxyuridine (EdU) pendant 4 h et traitées selon le protocole du fabricant (Click-iT® EdU Alexa Fluor® 488 Imaging Kit, Thermo Fisher). Avant l'imagerie, les cellules ont ensuite été colorées avec 5 ng/ml Hoecsht 3342 pendant 15 min. Les cellules colorées ont été analysées à l'aide d'un système de microscope Leica. L'analyse statistique a été effectuée au point final à travers les répétitions, comme indiqué dans les légendes de la figure.

Essai d'invasion

Du collagène I dérivé de queue de rat (Corning) a été supplémenté avec 25 µg/ml de fibronectine humaine (Sigma) dans du DMEM et polymérisé dans des inserts Transwell de 8 µm (Corning) pendant 30 min à température ambiante puis 30 min à 37°C/5 % CO2. 5 x 104 cellules BT20 ont été ensemencées au verso de chaque insert et incubées pendant 6 h à 37°C/5% CO2. Les inserts ont été doucement lavés et placés dans du DMEM sans sérum et la chambre supérieure remplie de DMEM additionné de 10 % de FCS (Life Technologies) et de PBS ou 100 ng/ml de FGF10 (PeproTech). Après 72 h, les cellules ont été colorées avec 500 ng/ml de Calcéine AM (Thermo Fisher) pendant 1 h et visualisées par microscopie confocale inversée Leica Sp8 en coupes en série de 20 µm. L'intensité de fluorescence de chaque section a été déterminée en utilisant ImageJ v. 1.52p (Schindelin et al, 2012 ) et la proportion de cellules envahissantes estimée en comparant l'intensité totale au-delà de 40 µm avec l'intensité globale totale par insert à l'aide de GraphPad PRISM version 8.0.0. L'analyse statistique a été effectuée au point final à travers les répétitions, comme indiqué dans les légendes de la figure.

Immunofluorescence

La coloration par immunofluorescence a été réalisée comme décrit précédemment (Francavilla et al, 2016). Pour détecter HA-FGFR2b ou FGFR2 endogène, nous avons incubé des cellules avec 10 g/ml d'anticorps anti-HA (Covance) ou anti-FGFR2 (Cell Signalling) pendant 45 minutes sous agitation douce. La liaison de l'anticorps n'a pas activé la signalisation du récepteur dans les cellules non traitées ni induit l'internalisation du récepteur (voir les cellules témoins sur la figure 1), comme indiqué précédemment (Francavilla et al, 2009). Après stimulation, les cellules ont été incubées à 37°C à différents moments. Lorsqu'indiqué, chaque inhibiteur a été ajouté avant la stimulation. À chaque instant, les cellules non perméabilisées ont été soit fixées pour visualiser le récepteur à la surface cellulaire (membrane plasmique) soit lavées à l'acide dans un tampon glacé (50 mM de glycine, pH 2,5) pour éliminer l'anticorps lié à la surface. Les cellules lavées à l'acide ont ensuite été fixées et perméabilisées pour visualiser le récepteur internalisé (cytoplasme). Enfin, pour détecter les cellules FGFR2b ont été colorées avec AlexaFluor488-anti-souris d'âne ou anti-lapin conjugué (Jackson ImmunoResearch Laboratories). Les noyaux ont été colorés au DAPI. Les lamelles ont ensuite été montées dans un support de montage (Vectashield Vector Laboratories).

Pour les expériences de co-localisation, les cellules ont été lavées à l'acide, fixées, perméabilisées avec 0,02% de saponine (Sigma), traitées avec un anticorps primaire contre FGFR2, EGFR, TTP, RCP, phosphorylée T693 EGFR, EEA1 pendant 60 min à 37°C et coloré avec AlexaFluor488 (ou 568 ou 647)-anti-souris d'âne ou anti-lapin conjugué. Les échantillons exprimant des protéines marquées GFP ou traités avec de la TRITC-transferrine ou de l'Alexa 647-transferrine (pour colorer le récepteur de la transferrine, Tf-R), ajoutés au milieu à une concentration finale de 50 g/mL, ont été conservés dans l'obscurité. Les noyaux ont été colorés au DAPI. Les lamelles ont ensuite été montées dans un support de montage (Vectashield Vector Laboratories).

Toutes les images ont été acquises à température ambiante sur un confocal inversé Leica TCS SP8 AOBS en utilisant un objectif à immersion d'huile 100x et un zoom confocal 2,5x. Les réglages confocaux étaient les suivants : sténopé, 1 unité aérée, format, 1 024 × 1 024. Les images ont été collectées en utilisant les paramètres de miroir de détection suivants : FITC 494-530nm Texas rouge 602-665nm Cy5 640-690nm. Les images ont été collectées séquentiellement. Les images brutes ont été exportées sous forme de fichiers.lsm et les ajustements de contraste et de luminosité de l'image ont été appliqués de manière identique pour toutes les images d'une expérience donnée à l'aide du logiciel disponible gratuitement ImageJ v. 1.52p (Schindelin et al, 2012 ).

Quantification du dosage de recyclage

La quantification du recyclage a été effectuée comme décrit (Francavilla et al, 2016). Pour chaque point temporel et chaque traitement, la présence (totale) et la localisation (surface cellulaire versus internalisée) de HA-FGFR2 ou de FGFR2 endogène ont été évaluées dans au moins sept champs choisis au hasard. Environ 100 cellules par condition (à la fois lavées à l'acide et non) ont été analysées à partir de trois expériences indépendantes. Les résultats sont exprimés en pourcentage de cellules positives pour le récepteur (vert) par rapport aux cellules totales (correspondant aux noyaux colorés au DAPI) et se réfèrent aux valeurs obtenues au temps zéro. L'analyse statistique a été effectuée à travers les répétitions, comme indiqué dans les légendes de la figure.

Quantification de la fraction d'expression, de la fraction de chevauchement et de la colocalisation

Les images ont été prétraitées à l'aide d'un filtre passe-bande à ondelettes « À trous » pour réduire la contribution du bruit moucheté à haute fréquence aux calculs de co-localisation. Les intensités de pixels ont ensuite été normalisées à partir de la plage de 8 bits d'origine [0,255] à [0,1]. Pour s'assurer que la colocalisation n'était calculée que dans des régions d'intérêt (ROI) bien déterminées, nous avons utilisé le Fiji/ImageJ (Schindelin et al, 2012) gestionnaire de retour sur investissement intégré pour créer et enregistrer ces régions.

Enfin, pour quantifier le niveau réel de co-localisation entre deux marqueurs (e.g. R et G), nous avons utilisé les coefficients de co-localisation de Manders (MCC) M1 et M2 (Manders et al, 1996). M1 mesure la fraction du marqueur R dans les compartiments qui contiennent également le marqueur G, et M2, la fraction du marqueur G dans les compartiments qui contiennent également le marqueur R. Seuils inférieurs pour les intensités de pixels jeR et jeg ont été déterminés automatiquement selon la méthode Costes (Costes et al, 2004 ).

Pour mesurer le chevauchement simultané de nos trois marqueurs, rouge, rouge lointain et vert (R, F, G), nous avons d'abord utilisé l'image de chevauchement entre le marqueur R et le marqueur F tel que défini ci-dessus (c'est-à-dire IF, R = jeF × jeR). Nous avons ensuite mesuré le paramètre de co-localisation MCC de cette image combinée contre un marqueur vert en utilisant les formules MCC ci-dessus, ainsi que la méthode Costes pour déterminer le TFR et Tg seuils.

Les scripts pour la quantification de la co-localisation ont été écrits en langage Python, et le code du MCC ajusté par Costes a été repris textuellement du CellProfiler (McQuin et al, 2018 ) base de code.

Le test t de Student a ensuite été utilisé pour déterminer la différence de fraction de chevauchement de pixels ou de coefficient de Manders (Costes) entre les différentes conditions expérimentales des figures 1 et 5, et des figures S4 et S6 de l'annexe.


Fond

La maladie d'Alzheimer (MA) est une maladie neurodégénérative progressive courante caractérisée par une perte neuronale sévère conduisant à un dysfonctionnement cognitif. À l'heure actuelle, aucun médicament ou traitement efficace n'a été disponible pour la prévention ou la guérison de cette maladie [1,2,3]. La principale caractéristique neuropathologique de la MA est l'agrégation et le dépôt de peptides amyloïdes (Aβ) qui sont considérés comme l'un des principaux facteurs de risque et causes de la MA [3, 4]. Les peptides Aβ agrégés jouent un rôle essentiel dans la dégénérescence neuronale, la neuroinflammation et le stress oxydatif [5, 6]. Ainsi, des approches thérapeutiques pour l'élimination efficace des dépôts d'Aβ peuvent offrir des avantages neuroprotecteurs dans la MA.

Selon des études récemment publiées, la MA peut être exacerbée par la neuroinflammation ainsi que par les peptides Aβ. La neuroinflammation est principalement médiée par les cellules microgliales qui sont des cellules immunitaires résidentes dans le système nerveux central (SNC) [6, 7]. Dans des conditions physiologiques, les cellules microgliales sont impliquées dans diverses fonctions, notamment la régulation du développement cérébral, le maintien de l'homéostasie et l'élimination d'anciennes synapses ou d'autres débris tels que les peptides Aβ. Dans la MA, il est connu que la microglie est activée de manière chronique, entraînant une altération de la clairance Aβ, une surexpression des signaux pro-inflammatoires et, par conséquent, une neurotoxicité [8, 9]. Par conséquent, la régulation de l'activation microgliale peut être une stratégie thérapeutique importante de la MA en réduisant la chimiotaxie immunitaire pro-inflammatoire excessive et en améliorant la fonction neuroprotectrice, conduisant à la modulation de la neuroinflammation [10, 11].

L'activation microgliale joue un rôle important dans plusieurs cascades de signaux pro-inflammatoires bien connues [12], y compris celles médiées par la protéine kinase activée par les mitogènes (MAPK). La famille MAPK est une famille de sérine/thréonine protéine kinase régulant les propriétés cellulaires en réponse à des stimuli extracellulaires tels que les facteurs de croissance et les cytokines inflammatoires [13]. Les MAPK P38, l'une des trois MAPK des cellules de mammifères, sont principalement activées par les cytokines inflammatoires et les stress environnementaux [14]. Les MAPK P38 ont quatre isoformes α, , et δ qui peuvent être divisées en deux sous-groupes, l'un est p38α et p38β, et l'autre est p38γ et p38δ [15]. Parmi celles-ci, les MAPK p38α et p38β sont fortement exprimées dans le cerveau de souris adultes [16]. SB203580, un inhibiteur traditionnel de p38α/β MAPK, a montré des effets thérapeutiques dans le modèle de dépression induite par le LPS et le modèle de souris AD [17, 18]. Récemment, deux inhibiteurs sélectifs de p38α MAPK, le néflamapimod (VX-745) et MW150, ont également montré des effets thérapeutiques respectivement chez des rats âgés et un modèle de souris AD [19, 20]. Les essais cliniques de phase 2a du néflamapimod ont montré des améliorations de la mémoire épisodique chez les patients atteints de MA précoce [21, 22]. Ces résultats suggèrent que les MAPK p38α/β sont des cibles potentiellement importantes dans la thérapeutique de la MA, et ainsi, leurs inhibiteurs peuvent être des médicaments prometteurs.

Dans notre étude précédente, un nouvel inhibiteur sélectif de p38α/β MAPK, NJK14047, pourrait améliorer avec succès la neuroinflammation médiée par la microglie [23]. Il a réduit les réponses inflammatoires médiées par le lipopolysaccharide (LPS) dans les cellules BV2 et le modèle murin. Sur la base de cette découverte, nous avions l'intention d'étudier le potentiel de NJK14047 en tant qu'agent thérapeutique pour la MA. Dans cette étude, nous avons utilisé cinq souris transgéniques de la maladie d'Alzheimer familiale (5XFAD) qui ont été couramment utilisées comme modèles de souris AD. Les souris 5XFAD surexpriment la protéine précurseur amyloïde humaine (hAPP) avec trois mutations FAD [suédois (K670N, M671L) Floride (I716V) et Londres (V717I)] et la préséniline 1 humaine (PS1) avec deux mutations FAD (M146L et L286V) sous contrôle du neurone spécifique Thy1 promoteur [24]. Ici, l'administration de NJK14047 au modèle de souris 5XFAD a été suggérée pour améliorer la perte de mémoire, le dépôt d'Aβ, la neuroinflammation et la dégénérescence neuronale via l'inhibition sélective des MAPK p38α/β.


RÉSULTATS

Le complément active p38 dans GEC. Nous et d'autres avons signalé précédemment que le complément C5b-9 active des kinases telles que la protéine kinase C, ERK (3) et JNK (31) dans GEC. Dans la présente étude, nous avons examiné si le complément active une autre MAPK, p38. Lorsque les GEC sensibilisés aux anticorps ont été exposés à la NS pour former le complément C5b-9, la phosphorylation de p38 a augmenté de 2,2 ± 0,5 fois, par rapport au témoin (cellules exposées à HIS) [pas de traitement 0,7 ± 0,1, HIS 1,0, NS 2,2 ± 0,5 (P < 0,01 vs HIS), anisomycine 4,6 ± 1,4 (P < 0,001 contre HIS), m = 6 Fig. 1UNE]. L'activité enzymatique de p38 quantifiée par dosage de la kinase du complexe immun a également augmenté dans les cellules traitées par le complément de 2,4 ± 0,3 fois, en corrélation avec l'augmentation de la phosphorylation [pas de traitement 0,4 ± 0,3, HIS 1, NS 2,4 ± 0,3 (P < 0.01 vs HIS), H2O2 4.5 ± 1.1 (P < 0,05 contre HIS), m = 3–4 Fig. 1B]. Pour vérifier si l'assemblage de C5b-9 était réellement requis pour l'activation de p38, nous avons incubé des GEC traités avec des anticorps avec C8D, avec ou sans reconstitution avec C8 purifié. C8D sans C8 forme C5b-7, qui s'est précédemment avérée biologiquement inactive dans GEC (2). GEC incubé avec C8D n'a pas montré de phosphorylation p38 significative, par rapport à HIS. Cependant, lorsque C8D a été reconstitué avec C8 purifié, la phosphorylation de p38 était évidente, indiquant que la formation de C5b-9 est nécessaire pour l'activation de p38 (Fig. 1C). L'analyse densitométrique a montré que la phosphorylation relative de p38 était HIS : 1,0, C8D : 0,9, C8D + C8 : 2,4 (moyenne de 2 expériences Fig. 1C).

Fig. 1.Le complément C5b-9 stimule p38 dans les cellules épithéliales glomérulaires (GEC) en culture. UNE: GEC-phospholipase A cytosolique2 (cPLA2) (GEC qui surexpriment de manière stable la cPLA2, voir matériels et méthodes ) ont été incubés avec un antisérum anti-GEC (5% vol/vol, 22°C, 40 min) et du sérum humain normal (NS 2,5% vol/vol, pour assembler C5b-9, 37°C, 40 min) ou sérum inactivé par la chaleur (HIS 2,5% vol/vol, contrôle). L'anisomycine (1 M) a été utilisée comme témoin positif. Sommet: immunoblot. Bas: densitométrie. *P < 0.01, **P < 0,001 par rapport à HIS m = 6 pour chaque groupe. B: GEC-cPLA2 ont été stimulés comme dans UNE, et l' activité p38 dans les lysats cellulaires a été évaluée comme dans les matériaux et les méthodes . H2O2 (1 mM) a été utilisé comme contrôle positif. Sommet: immunoblot. Bas: densitométrie. +P < 0.01, ++P < 0.05 par rapport à HIS m = 3-4 pour chaque groupe. C: GEC-cPLA sensibilisé aux anticorps2 ont été incubés avec du HIS (2,5 % vol/vol), du sérum humain déficient en C8 (C8DS 2,5 % vol/vol) ou du C8DS supplémenté en C8 humain recombinant (80 µg/ml dans du sérum non dilué) pendant 40 min à 37°C. H2O2 (1 mM) a été utilisé comme contrôle positif. Sommet: immunoblot. Bas: densitométrie (moyenne de 2 expériences).

Pour évaluer si l'activation de p38 médiée par le complément se produit in vivo, nous avons ensuite étudié l'activation de p38 dans les glomérules de rats atteints de PHN. La NPH a été induite par une seule injection d'antisérum anti-Fx1A (matériels et méthodes), et les glomérules ont été isolés 14 jours plus tard, lorsque les rats ont développé une protéinurie significative (∼160 mg/jour, rat témoin : <10 mg/jour). p38 a été activé d'environ six fois dans les glomérules de rats atteints de PHN, par rapport au témoin (contrôle 13 ± 1, PHN 80 ± 22, P < 0.05, m = 3 et 6 Fig. 2UNE). La phosphorylation de p38 était également plus élevée dans la PHN (2,9 ± 0,2 fois), par rapport au témoin (contrôle 1 ± 0,1, PHN 2,9 ± 0,2, P < 0.01, m = 3 et 6 Fig. 2B). Ces résultats indiquent que p38 est activé par le complément dans les GEC in vitro et in vivo.

Figure 2.p38 est activé dans les glomérules de rats atteints de néphrite passive de Heymann (PHN). UNE: PHN a été induite par injection intraveineuse d'antisérum de mouton anti-Fx1A. Au jour 14, les rats ont été tués et les glomérules ont été préparés par tamisage différentiel. Les lysats glomérulaires ont été analysés pour l'activité p38 (UNE) ou phosphorylation p38 (B) comme sur la figure 1. Sommet: immunoblot. Bas: densitométrie. *P < 0.05, **P < 0,01 par rapport au témoin m = 3 à 6 rats pour chaque groupe.

L'acide arachidonique contribue à l'activation de p38 induite par le complément. Nous avons ensuite abordé les mécanismes d'activation de p38 induite par le complément. Il a été rapporté précédemment que le complément active le cPLA2 dans un [Ca 2 + ]je- et de manière dépendante de la protéine kinase C, conduisant à une libération d'acide arachidonique du pool phospholipidique membranaire (16). Nous avons également signalé que l'activation de JNK induite par le complément était, au moins en partie, médiée par la libération d'acide arachidonique (17). Nous avons d'abord étudié si la libération d'acide arachidonique contribuait à l'activation de p38 induite par le complément. GEC-cPLA2 ont été stimulés avec des anticorps et du complément, et l'activation de p38 a été comparée avec des GEC témoins, qui ont été transfectés avec le vecteur uniquement (GEC-Neo). p38 a été activé par le complément 1,4 ± 0,1 fois dans GEC-Neo, alors que la stimulation était de 2,0 ± 0,1 fois dans GEC-cPLA2 (m = 3, P < 0,02), suggérant que la libération d'acide arachidonique, au moins partiellement, contribue à l'activation de p38 induite par le complément (Fig. 3UNE). Lorsque les GEC-Neo ont été stimulés avec de l'acide arachidonique exogène (30 M), p38 a été clairement activé (2,8 ± 0,6 fois le contrôle, P < 0.05, m = 5), soutenant le rôle de l'acide arachidonique dans l'activation de p38 (Fig. 3B).

Figure 3.L'acide arachidonique (AA) contribue à l'activation de p38 induite par le complément. UNE: GEC-Neo (cellules transfectées avec un vecteur) et GEC-cPLA2 (GEC qui surexpriment de manière stable la cPLA2) ont été stimulés avec du complément pendant 40 min, et la phosphorylation de p38 a été étudiée par immunoblot. Sommet: immunoblot. Bas: densitométrie. *P < 0,05 vs GEC-Neo m = 3 chacun. B: GEC-Neo ont été stimulés avec de l'AA (30 M) ou du véhicule [éthanol, contrôle (cntl)] pendant 20 min, et la phosphorylation de p38 a été étudiée par immunoblot. Sommet: immunoblot. Bas: densitométrie. **P < 0,05 par rapport au témoin m = 5 chacun.

Les GEC de rat en culture non stimulées expriment la COX-1, tandis que l'expression de la COX-2 est induite par le complément. Acide arachidonique libéré par cPLA2 est en outre converti par COX-1 et -2 en eicosanoïdes biologiquement actifs tels que PGE2, PGF2??, et TXA2 (29). Ces eicosanoïdes agissent via des récepteurs de surface cellulaire spécifiques respectifs de manière autocrine et sont connus pour activer p38 dans certains systèmes. Pour étudier si les eicosanoïdes contribuent à l'activation de p38 induite par le complément, nous avons stimulé la GEC avec la PGE2, PGF2??, et U-46619 (analogue stable de TXA2). Lorsqu'ils ont été testés individuellement, ces trois eicosanoïdes n'ont pas réussi à activer p38 de manière cohérente. Ce n'est que lorsque trois eicosanoïdes ont été testés simultanément qu'il y a eu une augmentation modeste de la phosphorylation de p38 (∼20%, non montré). De plus, un inhibiteur de COX non sélectif, l'indométacine, n'a pas réussi à inhiber l'activation de p38 induite par le complément (non montré). Pris ensemble, ces résultats indiquent que l'acide arachidonique contribue à l'activation de p38 induite par le complément, mais pas par sa conversion en métabolites COX. Au lieu de cela, l'acide arachidonique lui-même et/ou d'autres médiateurs stimulés par l'acide arachidonique, tels que les espèces réactives de l'oxygène (ROS) (voir Rôle des ROS dans l'activation de p38 par le complément), peut être responsable de l'activation de p38.

Rôle des ROS dans l'activation de p38 par le complément. Nous avons précédemment montré que le complément stimule la génération de ROS dans GEC d'une manière dépendante de la NADPH oxydase, ce qui contribue à l'activation de JNK (17). Nous avons également montré que l'acide arachidonique stimule la génération de ROS dans les GEC (17). Pour tester si les ROS contribuent à l'activation de p38 médiée par le complément, nous avons examiné l'activation de p38 médiée par le complément dans des GEC traités avec des antioxydants, du GSH et de la NAC. Comme le montre la figure 4, le GSH (10 mM) et le NAC (10 mM) ont complètement aboli la phosphorylation de p38 induite par le complément [contrôle 3,7 ± 0,3 fois de HIS, GSH 0,9 ± 0,03 fois de HIS (P < 0,01 vs contrôle), NAC 1,0 ± 0,07 fois de HIS (P < 0,01 par rapport au témoin), m = 3]. Ainsi, les ROS sont susceptibles d'être responsables de l'activation de p38 induite par le complément. Un mécanisme de génération de ROS pourrait être l'acide arachidonique libéré par cPLA2 (17).

Figure 4.L'activation de p38 médiée par le complément dépend des espèces réactives de l'oxygène. GEC-cPLA2 ont été stimulés avec des anticorps et du complément (NS). Les cellules ont été préincubées avec du glutathion (GSH 10 mM) ou N-acétylcystéine (NAC 10 mM) pendant 30 min avant la stimulation. L'activation de p38 a été évaluée par immunoblot pour le phospho-p38. Sommet: immunoblot. Bas: densitométrie. *P < 0,01 par rapport au témoin m = 3 chacun.

Impact de l'activation de p38 sur la fonction GEC. Nous avons ensuite étudié l'impact de l'activation de p38 sur les lésions GEC médiées par le complément. Nous avons initialement émis l'hypothèse que l'activation de p38 contribue aux lésions cellulaires médiées par le complément. Cependant, à notre grande surprise, lorsque les GEC ont été prétraités avec des inhibiteurs de p38 (PD-169316 et FR-167653, 10 M chacun), la cytotoxicité induite par le complément quantifiée par la libération spécifique de BCECF (voir matériels et méthodes) a été significativement augmentée, par rapport au véhicule- cellules traitées [Fig. 5UNE: DMSO : NS 2,5 13 ± 3%, NS 2,75 24 ± 5%, NS 3 38 ± 5%, PD-169316 : NS 2,5 20 ± 3% (P < 0,05 vs DMSO), NS 2,75 29 ± 4% (P < 0,05 vs DMSO), NS 3 46 ± 4% (P < 0,05 par rapport au DMSO), m = 3–4 Fig. 5B: DMSO : NS 2,5 18 ± 5 %, NS 2,75 36 ± 7 %, NS 3 49 ± 9 %, FR-167653 : NS 2,5 26 ± 7 % (P < 0,05 vs DMSO), NS 2,75 45 ± 7%, NS 3 58 ± 8% (P < 0,05 par rapport au DMSO), m = 3-4]. La concentration de FR-167653 utilisée (10 uM) a inhibé l'activité p38 induite par le complément de 90 % dans GEC (données non présentées). Des résultats similaires ont été obtenus lorsque la libération de LDH a été utilisée pour quantifier la cytotoxicité [DMSO : NS 5 25 ± 9 %, NS 7,5 36 ± 10 %, FR-167653 : NS 5 29 ± 11 %, NS 7,5 52 ± 10 % (P < 0,05 par rapport au DMSO), m = 6]. Ces résultats suggèrent que l'activation de p38 peut protéger les cellules contre les lésions médiées par le complément.

Figure 5.Les inhibiteurs de p38 augmentent les lésions GEC induites par le complément. Les GEC ont été préincubées avec les inhibiteurs de p38 PD-169316 (UNE10 M) ou FR-167653 (B 10 M) pendant 30 min à 37°C avant stimulation par anticorps et complément. Le véhicule (DMSO) a été utilisé comme témoin. Des inhibiteurs ont également été inclus dans des incubations avec un antisérum anti-GEC et HIS/NS. Après 40 min d'incubation avec HIS/NS, la cytotoxicité a été quantifiée par un dosage de libération de 2′,7′-bis(carboxyéthyl)-5(6)-carboxyfluorescéine (BCECF) comme dans les matériaux et méthodes. Les chiffres à côté de NS indiquent la concentration de NS (vol/vol) utilisée. *P < 0,05 par rapport au véhicule m = 3-4 pour chaque groupe.

Nous et d'autres avons déjà signalé que le complément C5b-9 perturbe les microfilaments d'actine dans les GEC cultivés (30, 33). Un mécanisme possible pour la cytoprotection médiée par p38 pourrait être via la modulation du cytosquelette d'actine. Ainsi nous avons ensuite étudié l'impact du FR-167653 sur la dépolymérisation de l'actine induite par le complément. Lorsque GEC-cPLA2 ont été incubés avec des anticorps et du complément pendant 3 h, la teneur en F-actine a diminué de 9 ± 3%. FR-167653 (10 M) a augmenté significativement la réduction à 18 ± 4% (P < 0.05, m = 5 chacun). Ainsi, l'activation de p38, au moins en partie, empêche la dépolymérisation de l'actine induite par le complément.

Pour valider davantage ces résultats, nous avons ensuite généré des sous-clones de GEC qui expriment de manière inductible un mutant constitutivement actif de TAK1, une kinase en amont de p38 (matériels et méthodes). Lorsqu'un tel clone (Fig. 6UNE, #1) a été stimulée avec une hormone d'insecte, la ponastérone A, l'expression de TAK1 a été induite après 2 h, avec un pic à 6 h. La phosphorylation de p38 a également été observée et a culminé à 6 h (Fig. 6UNE). La ponastérone A n'a pas d'impact connu sur les cellules de mammifères. Lorsque ce clone inductible a été stimulé avec de la ponastérone A pendant 6 h et exposé à des anticorps et à des concentrations croissantes de complément (NS), la cytotoxicité médiée par le complément a été atténuée par rapport aux témoins (incubés avec de l'éthanol à la place de la ponastérone A). A l'inverse, lorsque les cellules ont été préincubées avec l'inhibiteur de p38 FR-167653 (10 M, sans stimulation par la ponastérone A), la cytotoxicité a été augmentée, par rapport au témoin, en accord avec les résultats précédents (Fig. 6B). Fait intéressant, lorsque les cellules ont été stimulées avec de la ponastérone A en présence de FR-167653, l'impact de la ponastérone A (induction de TAK1) a été neutralisé, mais la cytotoxicité n'a pas atteint le niveau du traitement FR-167653 seul [contrôle 47 ± 1%, ponastérone A 33 ± 3% (P < 0,02 par rapport au témoin), ponastérone A plus FR-167653 43 ± 3%, FR-167653 seul 57 ± 2% (P < 0,05 vs contrôle) Fig. 6C]. Ces résultats indiquent que l'effet cytoprotecteur de l'induction de TAK1 est, au moins en partie, médié par l'activation de p38. Cependant, il pourrait y avoir des voies supplémentaires en aval de TAK1, qui contribuent à la cytoprotection.

Figure 6.L'induction de la kinase 1 activée par le facteur de croissance transformant constitutivement actif (TAK1) améliore les lésions GEC induites par le complément. Un sous-clone de GEC qui surexprime TAK1 (mutant constitutivement actif) de manière inductible a été établi comme dans les matériaux et méthodes. UNE: déroulement temporel de l'induction TAK1. Les GEC ont été incubés avec de la ponastérone A (pona 4 M) pendant les temps indiqués et les lysats cellulaires ont été analysés pour l'expression de TAK1 et la phosphorylation de p38 par immunoblot en utilisant des anticorps pour HA (TAK1) et phospho-p38, respectivement. Dans cloner #1, l'induction de TAK1 a culminé à 6 h lorsque la phosphorylation de p38 a également été observée. Dans cloner #3, l'induction de TAK1 était faible et la phosphorylation de p38 n'a pas été détectée. B: cloner #1 a été incubée avec le véhicule (témoin), la ponastérone A (4 M), ou FR-167653 (10 M) pendant 6 h et stimulée avec un antisérum anti-GEC et NS (ou HIS). La cytotoxicité médiée par le complément a été quantifiée comme dans les matériaux et les méthodes utilisant la libération de BCECF dans le milieu. *P < 0.05, **P = 0.07, ***P = 0,06 vs contrôle m = 3 chacun. C: cloner #1 a été incubé avec véhicule (témoin), ponasterone A (4 M), ponasterone A (4 M) + FR-167653 (10 M) ou FR-167653 (10 M) pendant 6 h et stimulé avec anti-sérum anti-GEC et NS (ou SES 3,5% vol/vol). La cytotoxicité a été quantifiée comme dans les matériaux et les méthodes. +P < 0.02, ++P < 0,05 par rapport au témoin m = 3 chacun. (B et C: expériences indépendantes.)

L'inhibition de l'activation de p38 augmente la protéinurie dans la PHN. Les résultats ci-dessus suggèrent que l'activation de p38 est cytoprotectrice pour les GEC contre les lésions cellulaires induites par le complément in vitro. Nous avons ensuite examiné si l'activation de p38 est également cytoprotectrice in vivo en utilisant le modèle de rat PHN de néphropathie membraneuse. Dans la PHN, il est connu que le complément C5b-9 provoque une lésion GEC, ce qui conduit à une protéinurie (21, 32). Comme le montre la figure 2, p38 a été significativement activé dans les glomérules de rats atteints de PHN, par rapport aux rats témoins. Nous avons prévu que si p38 est cytoprotecteur pour GEC, l'inhibition de p38 conduirait à une protéinurie augmentée dans PHN. Ainsi, nous avons examiné l'impact d'un inhibiteur spécifique de p38, FR-167653, sur la protéinurie. Premièrement, pour confirmer l'effet du FR-167653, des rats ont été traités avec le FR-167653 de jour 7 à 14 ( matériels et méthodes ) et l' activité p38 dans les glomérules a été étudiée sur jour 14. Chez les rats traités avec FR-167653, l'activité de p38 dans les glomérules a été nettement inhibée à un niveau comparable à celui des rats témoins [contrôle 13 ± 1, PHN 80 ± 22 (P < 0,05 vs contrôle), PHN-FR-167653 12 ± 5 (non significatif par rapport au contrôle), m = 3–6 Fig. 7UNE]. La phosphorylation de p38 n'a pas été affectée par cet inhibiteur de manière cohérente, en accord avec un rapport précédent (27) (Fig. 7UNE). Chez les rats traités avec le véhicule, l'excrétion urinaire des protéines sur jour 14 était de 161 ± 33 mg/jour (m = 7), significativement plus élevé que les rats normaux (∼10 mg/jour). Conformément à l'effet cytoprotecteur in vitro de l'activation de p38, les rats traités avec FR-167653 ont présenté une protéinurie augmentée (288 ± 54 mg/jour, P < 0,05 par rapport au véhicule, m = 9 Fig. 7B). Pour vérifier si l'activation du complément était influencée par FR-167653, nous avons quantifié le dépôt de C3 dans les glomérules (voir matériels et méthodes). Le dépôt glomérulaire de C3 était de 91 ± 4 chez les rats atteints de PHN et de 93 ± 3 chez les rats atteints de PHN traités avec FR-167653. Ainsi FR-167653 n'a pas affecté l'activation du complément dans les glomérules. Ces résultats soutiennent un rôle cytoprotecteur pour p38 dans les lésions GEC induites par le complément in vivo.

Fig. 7.L'inhibiteur de p38, FR-167653, augmente la protéinurie dans la PHN. La PHN a été induite par une injection unique d'antisérum anti-Fx1A, et les rats ont été traités avec le véhicule ou le FR-167653 comme dans les matériaux et méthodes. UNE: au jour 14, l' activité p38 glomérulaire a été mesurée comme dans les matériaux et méthodes . Sommet: immunoblot. Bas: analyse densitométrique. *P < 0,05 par rapport au témoin m = 3 à 6 rats dans chaque groupe. Les données de l'analyse densitométrique pour le contrôle et la PHN sont partagées avec la figure 2. B: au jour 14, l'urine de 24 heures a été recueillie dans des cages métaboliques et les protéines urinaires ont été quantifiées. **P < 0,05 par rapport au véhicule m = 7 (véhicule), 9 (FR-167653).

La surexpression de HSP27 protège les GEC des blessures. Les résultats ci-dessus indiquent des effets cytoprotecteurs de la voie p38 MAPK dans GEC. HSP27 est l'une des molécules en aval de p38 MAPK. Il est connu que lorsque la voie p38 MAPK est activée, MAPKAPK-2 est phosphorylée/activée et phosphoryle à son tour HSP27 (5). Il a été rapporté précédemment que dans le modèle de néphrose puromycine aminonucléoside (PAN) du rat, l'expression glomérulaire et la phosphorylation de HSP27 étaient augmentées (24). De plus, la surexpression de HSP27 dans les podocytes de souris a fourni une protection contre PAN (25). Nous avons également démontré que l'expression glomérulaire de HSP27 est augmentée d'environ 1,6 fois chez les rats atteints de PHN, par rapport aux rats témoins, similaire à l'augmentation observée dans la néphrose PAN (24) (Fig. 8UNE). Lorsqu'elle est traitée avec FR-167653, l'expression glomérulaire de HSP27 a montré une tendance à la hausse, bien que la différence ne soit pas statistiquement significative [contrôle 52 ± 2, PHN 84 ± 10 (P < 0,01 vs contrôle), FR-167653 117 ± 11 (P < 0,01 par rapport au témoin), m = 5 à 8 rats Fig. 8UNE]. Nous avons également étudié la phosphorylation de HSP27 en utilisant un anticorps spécifique de phospho-HSP27. La phosphorylation de HSP27 dans les glomérules était significativement augmentée dans la PHN (Fig. 8B). Contrairement à l'expression des protéines, la phosphorylation de HSP27 a été nettement inhibée par FR-167653 [contrôle 15 ± 2, PHN 64 ± 11 (P < 0,01 vs contrôle), FR-167653 34 ± 11, m = 6 rats chacun Fig. 8B]. Ces résultats suggèrent que la phosphorylation glomérulaire de HSP27 dans PHN est, au moins en partie, médiée par p38 MAPK.

Fig. 8.L'expression glomérulaire de la protéine de choc thermique (HSP27) est augmentée chez les rats atteints de PHN. La PHN a été induite par une seule injection d'antisérum anti-Fx1A et les rats ont été traités avec le véhicule ou le FR-167653 comme dans les matériaux et méthodes. Au jour 14, des lysats glomérulaires ont été préparés et analysés par immunoblot pour HSP27 (UNE) et phospho-HSP27 (B). Sommet: immunoblot. Bas: analyse densitométrique. *P < 0,01 par rapport au témoin m = 5 à 8 rats chacun.

Ainsi, nous avons ensuite étudié si l'effet cytoprotecteur de la voie p38 MAPK est médié via MAPKAPK-2 et HSP27 dans des GEC de rat en culture. Pour tester cette hypothèse, nous avons d'abord étudié si MAPKAPK-2 est phosphorylée par le complément en GEC. Lorsque les GEC ont été exposés à l'anticorps et au complément, la phosphorylation de p38 a été observée pendant 20 à 60 min (Fig. 9UNE). La phosphorylation de MAPKAPK-2 a été observée dans le même temps (Fig. 9UNE). Nous avons ensuite étudié l'impact de la surexpression de HSP27 sur les lésions GEC médiées par le complément. Le plasmide codant pour la HSP27 de type sauvage a été transfecté de manière stable dans GEC, et son expression a été vérifiée par immunoblot. Deux sous-clones (HSP27WT1 et 2) qui surexprimaient le HSP27 de type sauvage ont été sélectionnés pour une étude plus approfondie (Fig. 9B). Contrôle 1 est un sous-clone de GEC qui a été transfecté avec le vecteur seul et contrôle 2 a été transfecté avec le HSP27 de type sauvage mais le niveau d'expression était minime. Il convient de noter que les cellules témoins ont également exprimé HSP27 lorsque le film a été exposé plus longtemps (Fig. 9B). Lorsque HSP27WT1 et 2 ont été simulés avec des anticorps et du complément, la libération de LDH spécifique a été nettement atténuée, par rapport aux deux cellules témoins [NS 2.5 : contrôle 1 30 ± 4%, contrôle 2 24 ± 3%, HSP27WT1 6 ± 1% (P < 0,001 par rapport aux deux contrôles), HSP27WT2 7 ± 1% (P < 0,001 par rapport aux deux témoins), NS 5 : contrôle 1 56 ± 8%, contrôle 2 48 ± 5 %, HSP27WT1 10 ± 1 % (P < 0,001 par rapport aux deux contrôles), HSP27WT2 16 ± 1% (P < 0,001 par rapport aux deux témoins), NS 10 : contrôle 1 73 ± 6%, contrôle 2 66 ± 2%, HSP27WT1 25 ± 1% (P < 0,001 par rapport aux deux témoins), HSP27WT2 30 ± 1 % (P < 0,001 par rapport aux deux contrôles), m = 6–12 Fig. 9C]. Pour étudier si la phosphorylation de HSP27 est importante dans la cytoprotection, nous avons ensuite établi des sous-clones de GEC qui surexpriment un mutant non phosphorylable de HSP27. Dans ce mutant, deux résidus Ser qui sont connus pour être phosphorylés par MAPKAPK-2 sont mutés en Ala (10). Deux sous-clones (HSP27mut1 et 2) ont été choisis pour d'autres études (Fig. 9B). Contrôle 3 est un sous-clone de GEC qui a été transfecté avec le vecteur seul, et contrôle 4 a été transfecté avec HSP27mut, mais le niveau d'expression était minime. Lorsque HSP27mut1 et 2 ont été stimulées avec du complément, la libération spécifique de LDH était légèrement atténuée, par rapport aux cellules témoins, mais l'atténuation était beaucoup plus faible que dans les cellules surexprimant la HSP27 de type sauvage [NS 2.5 : contrôle 3 25 ± 4%, contrôle 4 29 ± 2%, HSP27mut1 19 ± 2%, HSP27mut2 31 ± 5%, NS 5 : contrôle 3 60 ± 3%, contrôle 4 48 ± 2%, HSP27mut1 41 ± 2% (P < 0,05 vs. contrôle 3), HSP27mut2 48 ± 2%, NS 10 : contrôle 3 66 ± 2%, contrôle 4 62 ± 1%, HSP27mut1 53 ± 1% (P < 0,05 par rapport aux deux contrôles), HSP27mut2 50 ± 3% (P < 0,05 vs. contrôle 3), m = 4–12 Fig. 9]. Ces résultats indiquent que la surexpression de HSP27 induit une cytoprotection dans les GEC et suggèrent que la phosphorylation de HSP27 médiée par MAPKAPK-2 est importante dans cette cytoprotection.

9.La surexpression de la HSP27 de type sauvage, mais pas d'un mutant non phosphorylable, protège les GEC contre les lésions cellulaires médiées par le complément. UNE: GEC-cPLA2 ont été stimulés avec des anticorps et du complément pendant les temps indiqués. Les lysats cellulaires ont été analysés par immunotransfert pour la phosphorylation de MAPKAPK-2 et p38. B: des sous-clones de GEC qui surexpriment de manière stable le hamster de type sauvage HSP27 (HSP27WT) ou un mutant non phosphorylable (HSP27mut) ont été établis comme dans les matériaux et les méthodes. L'expression de HSP27 a été vérifiée par immunoblot. Notez que le contrôle GEC exprime également HSP27 lorsqu'il est exposé plus longtemps. C: clones GEC qui ne surexpriment pas HSP27 (commande 1 et 2) et des clones GEC qui surexpriment la HSP27 de type sauvage (HSP27WT1 et 2) ont été sensibilisés avec un antisérum anti-GEC et stimulés avec des concentrations croissantes de NS (ou HIS) pendant 40 min. La libération spécifique de lactate déshydrogénase (LDH) a été quantifiée comme dans les matériaux et les méthodes comme marqueur de la cytotoxicité médiée par le complément. *P < 0,001 vs. commande 1 et 2 m = 6-12 par groupe. : clones GEC qui ne surexpriment pas HSP27 (commande 1 et 2) et des clones GEC qui surexpriment un mutant non phosphorylable de HSP27 (HSP27mut1 et 2) ont été stimulés avec du complément et la libération de LDH a été quantifiée. +P < 0,05 vs. commande 3. ++P < 0,05 vs. commande 4 m = 4 à 12 par groupe.


DISCUSSION

Cette étude élucide les mécanismes d'activation médiée par C5b-9 de la cascade ERK. L'activation d'ERK s'est déroulée via Ras et dépendait du remodelage du cytosquelette. L'ERK activée a phosphorylé deux substrats distincts, et l'activation chronique constitutive de la voie ERK a exacerbé la cytotoxicité dépendante du complément. Conformément aux résultats antérieurs, nous démontrons que dans les GEC en culture, C5b-9 a induit la phosphorylation de ERK thréonine 202/tyrosine 204 (Fig. 1), qui est en corrélation avec l'activation (10). En outre, nous montrons que ERK est phosphorylé dans les glomérules de rats atteints de PHN (c'est-à-dire, lésion GEC dépendante de C5b-9 in vivo), et la localisation de phospho-ERK est compatible avec GEC (Figs. 1 et 2). Dans des études précédentes, nous avons démontré que l'assemblage de C5b-9 dans la membrane plasmique GEC (en culture et in vivo) induisait une transactivation des récepteurs tyrosine kinases, y compris EGF-R (13). La transactivation de l'EGF-R a entraîné l'activation de la phospholipase C-γ1 et de la PKC, ainsi que la liaison de la protéine adaptatrice, Grb2, qui relie les récepteurs tyrosine kinases à Ras (11, 13). Pour déterminer le rôle de Ras et de PKC dans l'activation d'ERK médiée par le complément, nous avons surveillé la phosphorylation d'ERK dans les GEC qui avaient été transfectées de manière stable avec un mutant inhibiteur dominant de Ras, et dans les GEC appauvries en PKC. Ces expériences ont montré que la voie ERK était activée principalement via Ras (Fig. 3). Nos résultats sont distincts de ceux des cellules K562 et COS-7, où l'activation d'ERK induite par le complément s'est produite via PKC (21).

Le protocole utilisé dans la présente étude n'a pas entraîné de changements quantitatifs de la F-actine après l'incubation avec le complément, mais dans une autre étude (44), les lésions GEC par le complément ont été associées à la perte de fibres de stress d'actine et de contacts focaux. In vivo, les GEC contiennent de la F-actine sous forme de couche à la base des processus du pied, et le cytosquelette d'actine est important dans le maintien de l'architecture cellulaire. Auparavant, nous avons montré que les médicaments qui désassemblent le cytosquelette d'actine (cytochalasine D et latrunculine B) n'affectaient pas l'activation médiée par le complément de l'EGF-R mais inhibaient l'activation de la phospholipase C-γ1 et la signalisation en aval, y compris l'activation de la PKC et de la cPLA.2 (11). La présente étude démontre que l'activation d'ERK induite par le complément est inhibée par la cytochalasine D et la latrunculine B (Fig. 7, UNE et B). Les deux médicaments ont également inhibé l'activation d'ERK par EGF (qui se produit via le Ras et Raf) et la PKC (qui se produit via Raf, mais pas Ras) (Figs. 3 et 7). Ainsi, un cytosquelette d'actine intact est requis pour l'activation séquentielle de Raf, MEK et ERK. De plus, la cytochalasine D et la latrunculine B ont également bloqué la phosphorylation d'ERK dans les GEC qui surexpriment de manière stable R4F-MEK (Fig. 7F). Ce résultat implique qu'une phosphorylation efficace de ERK par MEK dépend d'un cytosquelette d'actine intact. Les actions de la cytochalasine D et de la latrunculine B sur la phosphorylation d'ERK étaient similaires, bien que la cytochalasine D et les latrunculines induisent la dépolymérisation du cytosquelette d'actine par différents mécanismes. La cytochalasine D se lie aux barbelés (extrémité en croissance) des filaments d'actine et empêche la formation de filaments d'actine ou entraîne une perturbation du retournement actif des fibres de stress d'actine. Les latrunculines séquestrent les monomères d'actine G empêchant la polymérisation de l'actine et perturbent efficacement à la fois les fibres de stress d'actine, ainsi que les filaments d'actine corticale, qui sont plus résistants à la cytochalasine D (23).

Semblable aux médicaments dépolymérisant l'actine, la condensation et la stabilisation des filaments d'actine à la périphérie cellulaire près de la membrane plasmique par la calyculine A ont inhibé l'augmentation induite par le complément de la phosphorylation de ERK (Fig. 7C). L'expression stable de L 63 RhoA a également atténué la phosphorylation d'ERK par le complément (Fig. 9) et cet effet est associé à une formation accrue de fibres de stress (11). L 63 RhoA peut avoir agi par un mécanisme analogue à la calyculine A, car il a été rapporté que RhoA constitutivement actif induisait la phosphorylation des protéines ezrine-radixine-moesine (4). Semblable à l'activation de RhoA, l'inhibition de la kinase associée à Rho (un effecteur en aval de RhoA) a réduit l'activation d'ERK (Fig. 9).Ensemble, les résultats suggèrent que le démontage et la stabilisation du cytosquelette d'actine peuvent réduire la phosphorylation d'ERK, ce qui implique que l'activation d'ERK dépend du remodelage du cytosquelette. Enfin, les médicaments modifiant le cytosquelette ont eu des effets disparates sur l'activation de la voie JNK dans GEC (Fig. 8). Ainsi, il existe des différences majeures dans le rôle du cytosquelette pour faciliter l'activation des voies par le complément, et le désassemblage pharmacologique du réseau de filaments d'actine n'exerce pas d'effet inhibiteur général sur toutes les voies de signalisation.

Notre étude, qui a révélé un rôle important du cytosquelette d'actine dans la signalisation du complément, s'inscrit dans la lignée des études menées dans d'autres systèmes. Par exemple, en réponse au traitement à l'insuline, le désassemblage du filament d'actine a bloqué l'activation d'ERK et de la kinase p38, mais pas l'autophosphorylation des récepteurs de l'insuline, la phoshatidylinositol 3-kinase ou la kinase S6 (42, 45). De plus, la liaison de Shc au récepteur de l'insuline n'a pas été affectée, mais la liaison de Grb2 à Shc a été interrompue (45). Cependant, la cytochalasine D n'a pas affecté l'activation d'ERK par l'acide lysophosphatidique, la bombésine ou le facteur de croissance dérivé des plaquettes (39). De plus, le cytosquelette d'actine peut être important dans la progression du cycle cellulaire, la transcription des gènes inductibles par le sérum et l'induction de l'oxyde nitrique synthase (51). Il peut sembler inhabituel que l'expression de la calyculine A et L 63 RhoA (qui facilitent la polymérisation de l'actine) produise des effets similaires à ceux de la cytochalasine D ou de la latrunculine B (qui dépolymérisent le cytosquelette) et inhibe la kinase associée à Rho. Tous ces traitements étaient inhibiteurs de l'activation d'ERK dans la présente étude, et des effets parallèles de l'augmentation de la polymérisation et de la dépolymérisation de l'actine ont été rapportés dans d'autres systèmes. Par exemple, la polymérisation de l'actine F avec le médicament jasplakinolide et la dépolymérisation avec la latrunculine B ou la cytochalasine D ont toutes deux inhibé l'absorption de glucose stimulée par l'insuline dans les adipocytes (20), la production médiée par les lipopolysaccharides d'espèces réactives de l'oxygène dans les monocytes (36), l'accumulation de phosphatidylinositol 3 ,4,5-trisphosphate en réponse à un stimulus chimiotactique dans les neutrophiles (48), et l'apoptose dans les cellules épithéliales des voies respiratoires (49).

Pour aborder le rôle fonctionnel de l'activation d'ERK médiée par le complément dans les GEC, nous avons examiné les substrats d'ERK, ce qui peut indiquer une implication potentielle dans les fonctions cellulaires (31). Le complément n'a pas induit la phosphorylation de la sérine 383 du facteur de transcription Elk-1, une cible nucléaire potentielle de ERK (Fig. 4). Comme prévu, l'EGF, un activateur bien connu d'ERK, a en fait induit la phosphorylation d'Elk-1. L'EGF a peut-être été capable d'activer/recruter des facteurs supplémentaires nécessaires à ERK pour phosphoryler les facteurs de transcription nucléaires, alors que le complément n'était pas efficace. Cependant, le complément a induit la phosphorylation de MAPKAPK-2, qui était, en partie, dépendante de la voie ERK (ainsi que de la kinase p38 Fig. 6). MAPKAPK-2 est plus typiquement un substrat de la kinase p38, mais par analogie avec la GEC, une activation dépendante de ERK de MAPKAPK-2 a été rapportée dans les neutrophiles (7). Dans des conditions basales, on pense que MAPKAPK-2 est situé dans le noyau, alors qu'à l'activation, MAPKAPK-2 peut phosphoryler des facteurs de transcription nucléaires ou être exporté dans le cytoplasme, où il peut activer d'autres substrats, y compris Hsp27 (27). Notre résultat soutient un rôle pour l'activation ERK médiée par le complément dans la transcription, ainsi que dans les voies cytoplasmiques. De plus, la phosphorylation stimulée par le complément de cPLA2, une cible ERK cytoplasmique sur la sérine 505 (Fig. 5), un site de phosphorylation ERK bien défini (18, 22). Fait intéressant, bien que la cPLA2 est un substrat pour ERK dans GEC, l'augmentation induite par le complément de cPLA2 l'activité catalytique dans ces cellules ne nécessitait pas l'activation d'ERK (10) mais dépendait de la PKC. Phosphorylation du cPLA2 Le site de la sérine 505 contribue à la libération d'acide arachidonique par l'EGF dans la GEC (10) et est en corrélation avec la cPLA stimulée par un agoniste2 activité dans d'autres cellules (22). Une étude plus approfondie sera nécessaire pour élucider d'autres substrats ERK.

Dans des études antérieures, nous avons démontré que l'activation induite par le complément des protéines kinases activées par les mitogènes JNK et p38 était cytoprotectrice dans les GEC, c'est-à-dire que JNK et p38 limitaient ou restreignaient la cytotoxicité du complément (1, 32). Le mécanisme de protection par p38 était, au moins en partie, dépendant de Hsp27, un substrat de MAPKAPK-2 (1). Cette étude suggère que le rôle de ERK dans les lésions GEC peut être plus complexe. L'inhibition de l'activation induite par le complément de la cascade ERK dans les GEC n'a pas affecté de manière significative la cytotoxicité du complément (Fig. 11). Cependant, un rôle cytoprotecteur pour ERK via MAPKAPK-2 et Hsp27 ne peut pas être exclu car l'activation de MAPKAP-2 ne dépendait que partiellement de ERK (Fig. 6). L'incubation chronique (mais pas brève) avec le complément en présence de cytochalasine D ou de latrunculine B a augmenté la lyse du complément (Fig. 10), mais la combinaison de l'inhibition de ERK et du désassemblage du cytosquelette n'a pas augmenté la lyse du complément au-delà de celle observée avec le désassemblage du cytosquelette seul (données pas montré). En revanche, la cytotoxicité du complément a été augmentée dans les GEC qui expriment de manière stable la MEK constitutivement active (Fig. 11). La cinétique d'activation d'ERK est susceptible d'être différente entre les deux conditions. Auparavant, nous avons démontré qu'au cours d'une incubation chronique avec le complément, la phosphorylation d'ERK était améliorée en 20 min et revenait vers les niveaux basaux en 5 h (13). En revanche, dans les GEC qui expriment de manière stable R4F-MEK, ERK reste activé en continu (25). Ainsi, la cytotoxicité dépendante du complément a été exacerbée par l'activation chronique et constitutive d'ERK. Dans une autre étude, l'inhibition d'ERK dans les cellules K562 et COS-7 a amélioré la lyse du complément (mesurée par l'absorption du bleu trypan) (21). Une étude récente dans GEC (33) a montré que le complément induisait des dommages à l'ADN et augmentait l'expression des gènes de régulation du cycle cellulaire, p21 et GADD45 (growth-arrest DNA damage-45). Dans cette étude, l'inhibition de la MEK a exacerbé les dommages à l'ADN et réduit les niveaux de p21 et de GADD45. Les auteurs ont conclu que l'activation d'ERK protège les GEC des dommages à l'ADN via la régulation des gènes p21 et GADD45. Cependant, bien que ces auteurs aient montré que le complément n'induisait pas l'apoptose, les lésions cytolytiques (par exemple, la libération de LDH) n'ont pas été examinées. De plus, les mêmes chercheurs ont démontré plus tôt que le C5b-9 peut induire la synthèse d'ADN (mais pas la prolifération) dans les GEC (40). Ainsi, l'effet de C5b-9 et ERK sur la régulation de l'ADN et les lésions cellulaires nécessitera une étude supplémentaire. Avec l'avènement de médicaments qui modulent les voies des protéines kinases, une meilleure compréhension de l'activation des protéines kinases par C5b-9 fournira des informations sur de nouvelles cibles pour le traitement des maladies glomérulaires.